miRNA discovery – exercise                        June 7 2007
thanks to Morten Lindow @ www.binf.ku.dk for ideas and for most of ex.1

These exercises are based on real data, and simulate situations that are likely to arise for an experimental biologist working in the miRNA discovery field. The exercises are open ended and there is more than one way to answer the questions.

 

Exercise 1: Characterization of a potential miR

From a human sarcoma cell line you have cloned the following sequence, which you suspect could be a miRNA:

>RNA1
taggtagtttcatgttgttgg

Q1.1: Where is the sequence encoded in the genome? Is it found in more than one place?
(Hint: The BLAT search at UCSC is useful for mapping sequences to the genome.
NB! The aim is to find a perfect match, not to search for homologs)

Q1.2: Is the sequence conserved in other organisms?
(Hint: Conservation track in the UCSC browser)

Q1.3: Could it be a miRNA? If so, is it new, or is it already known?
(Hint: extract surrounding sequence and fold it with RNAfold)

To study the function of RNA1 you decide to inhibit it with antisense LNA. After transfecting the anti-RNA1 LNA into your cell culture you perform an Affymetrix microarray experiment to look for changes in global gene expression. You observe that many genes are differentially expressed after transfection, and that the most strikingly upregulated gene in the experiment with the inhibitor has this Affy_probe_set_id: 221278_at.

Q1.4: What is the corresponding gene and the mRNA sequence for this Affy_id?
(Hint: You can use the UCSC Genome Browser)

Q1.5: Has this gene been associated with microRNAs before?
(Hint, search the literature, e.g. in PubMed)

Q1.6: Why do we see increased signal from probe 221278_at when RNA1 is inhibited?

Q1.7: What targets is the miRNA predicted to have? Is 221278_at among them?

Q1.8: Could there be a link between the miRNA and suffering from Trichotillomania, obsessive-compulsive pulling your hair?
(Hint: look in OMIM for the target gene)

Q1.9: What consequences could you envisage, if the miRNA was knocked out in vivo?

 

Exercise 2: Target prediction and evaluation

You wish to identify the targets of the miRNA: hsa-let-7e

 

Q2.1: How many targets do you identify by using three popular prediction methods?:

miRANDA

Targetscan

Pictar

 

(Hint: there are links to each method from miRBASE)

 

Q2.2: How well do the predictions agree? Draw a Venn diagram showing the overlap!

(Hint: First, the gene lists should be made comparable, e.g. by DAVID. Next, you may generate the Venn diagram by e,g, using the “Venn diagram creator”.

Q2.3: What would you suggest doing to validate the predicted targets?

 

Exercise 3: 454 discovery of novel miRs – or not?

The following five sequences were identified from a 454-run on breast cancer samples:

ACTCGGCGTGGCGTCGGTCG

ACTCGGCGTGGCGTCGGTCGT

ACTCGGCGTGGCGTCGGTCGTG

ACTCGGCGTGGCGTCGGTCGTGG

ACTCGGCGTGGCGTCGGTCGTGGT

 

Q3.1: Do these sequences represent novel miRNAs?

Q3.2: If so, how many?

Q3.3: How can the data be interpreted in terms of miRNA biogenesis and processing?