Events News Research CBS CBS Publications Bioinformatics
Staff Contact About Internal CBS CBS Other

Bioinformatics for Human Biologists - course programme, winter 2009


Teachers:

Curriculum:
The curriculum consists of hand-out notes and the computer exercises themselves. There is no formal text-book. All needed reading material will be available online, linked directly from this page. The material can be read on a day-to-day basis.

Exam:
The course is pass/fail based on participation (both lectures and exercises).

Where and when:
The Technical University of Denmark, Lyngby Campus, Building 208, Room 060 - it's in the basement - take the stairs down in the main hallway and turn left. It's the last room on the right, just before the big row of windows. Directions on how to get to DTU (Lyngby) and a map of the buildings are found here: DTU Directions.

The course runs for the duration of Week 2 (Mon 5th of January till Fri 9th of January) from 9:15 till ~16:00 (or wheneven the computer execersis of the day has been completed).
Each day starts with lectures in the morning, and concludes with computer excersices in the afternoon.


Hardware / Software used

The computer exercises can be executed from any internet connected computer (Mac, Linux, Windows) with a modern browser (e.g. FireFox, Safari or a recent version of Internet Explorer - a browser which supports tabs is recommended) and Java installed. Java is used in some exercises to run visualization software. Link: www.java.com.

We recomment the JEdit text editor for use on sequence files, since it is well suited for this purpose and is platform independent. Link: www.jedit.org.

For the protein structure exercise the PyMOL software (also cross-platform) will be used. Main link: www.pymol.org.

Free Student's version:

Username/password will be mailed to your all

Reporting:

Each group has to keep a "log book" with answers to the questions asked in the exercises. After completing an exercise, mail in the report: raz+humanbio@cbs.dtu.dk

The log book should be kept as minimalistic as possible - and it must be written in plain-text. It's strongly recommended to write in a simple text-only editor, such as JEdit introduced on this course.

The imporant thing here is to simply focus on giving a nice'n'simple overview of you answers and not to spent a lot of time on fancy formatting. For example:
Answers to the Multiple Alignment exercise
------------------------------------------
Report by: Rasmus Wernersson (v18103)

Question 1
----------
Fasta format file:

>goat_alpha_globin_II
ATGGTGCTGTCTGCCGCCGACAAGTCCAATGTCAAGGCCGCCTGGGGCAAGGTTGGCAGCAACGCTGGAG
CTTATGGCGCAGAGGCTCTGGAGAGGATGTTCCTGAGCTTCCCCACCACCAAGACCTACTTCCCCCACTT
CGACCTGAGCCACGGCTCGGCCCAGGTCAAGGGCCACGGCGAGAAGGTGGCCGCCGCGCTGACCAAAGCG
GTGGGCCACCTGGACGACCTGCCCGGTACTCTGTCTGATCTGAGTGACCTGCACGCCCACAAGCTGCGTG
TGGACCCGGTCAACTTTAAGCTTCTGAGCCACTCCCTGCTGGTGACCCTGGCCTGCCACCACCCCAGTGA
TTTCACCCCCGCGGTCCACGCCTCCCTGGACAAGTTCTTGGCCAACGTGAGCACCGTGCTGACCTCCAAA
TACCGTTAA
>xxx_yyy_qqq
ATAGATAGT ....


Question 2
----------
2a): xxxx yyyy zzzz
2b): ddd jjj uuu

Please note: We collect these answers for two purposes: 1) Assessing participation in the exercises. 2) As a means to improve our teaching, since we get a chance to learn what questions are typically difficult to answer or understand.


Course programme:

Monday 5th of January

Lecture 1: Introduction to the course. Evolution and DNA - Rasmus Wernersson.

Readnings: Brief Introduction to Evolutionary Theory - Text by Anders Gorm Pedersen.
Slides: Intro + Evolution

Lecture 2: Biological information, DNA structure and sequencing, GenBank searching - Rasmus Wernersson.

Readnings: GenBank (The yearly GenBank publication, 2008). DNA sequencing tutorial - source: IDT Tech Vault.
Slides: Biological information + DNA data
Hand outs: Chromatogram - GenBank + FASTA format.

Lecture 3: Proteins: data and databases - Morten Nielsen.

Readnings: The Universal Protein Resource (UniProt) (database paper). Virtual Ribosome (software paper).
Slides: PowerPoint slides.

Exercises: 1) Searching the GenBank - 2) Translation and Protein Databases.


Tuesday 6th of January

Lecture 1: Pairwise alignment - Anders Gorm Pedersen.

Readnings: Page 35-55 in Immunological Bioinformatics (PDF - extract from the Book - password protected)

Lecture 2: BLAST: Introduction to BLAST - Rasmus Wernersson.

Readnings: Same as above.
Slides: BLAST powerpoints
Handouts: BLOSUM62 matrix - BLASTN heuristics - BLASTP heuristics.

Exercises: 1) Pairwise alignment - 2) Using BLAST for sequence searches.


Wednesday 7th of January

Lecture 1: Protein 3D strukture - Thomas Blicher

Readnings: Protein Structure (Wikipedia - Frozen version).
Link to "Live" version: http://en.wikipedia.org/wiki/Protein_structure
Slides: Protein structure - Homology modelling

Lecture 2: PSI-BLAST - Morten Nielsen
Slides: PowerPoint slides.

Readnings: Page 68-80 in Immunological Bioinformatics (PDF - extract from the Book - password protected)

Exercises: 1) PDB and PyMOL - 2) PSI-BLAST.


Thursday 8th of January

Lecture 1: Multiple alignments - Anders Gorm Pedersen

Readnigs: Mutiple Sequence Alignment (Short software review paper). RevTrans (Short paper on an apporach which mixes DNA and protein alignment)

Phylogenetic trees - Anders Gorm Pedersen.

Readnings: Introduction to Treebuilding (PDF) - Evolutionary trees (except the section "How to reconstruct an evolutionary tree").
Hand-outs: handout exercise Reconstruction of a distance tree


Exercises: 1+2) Multiple Alignments & Phylogenetic trees.


Friday 9th of January

Lecture 1: Human Genome Browser - Thomas Nordahl Petersen

Readnings: UCSC Genome Browser, Update 2008 Slides: PowerPoint slides

Lecture 2: Prediction methods in immunological bioinformatics - Claus Lundegaard

Readnings: Modeling the adaptive immune system: predictions and simulations
Page 91-102 in
Immunological Bioinformatics (PDF - extract from the Book - password protected)
(The Neural Network equations will not be essential, and are not covered i detail)



Exercises: 1) HCV vaccine development. - 2) Using the UCSC Genome Browser.