Bioinformatics for Human Biologists - course programme, winter 2009

Teachers:

• Rasmus Wernersson - Main teacher and course organizer.
  
  
• Anders Gorm Pedersen - Alignment & Phylogenetic.
• Morten Nielsen - Protein databases, PSI-Blast.
• Claus Lundegaard - Prediction methods.
• Thomas Blicher - Protein structure.
• Thomas Nordahl Petersen - Human genome resources.

Curriculum:
The curriculum consists of hand-out notes and the computer exercises themselves. There is no formal text-book. All needed reading material will be available online, linked directly from this page. The material can be read on a day-to-day basis.

Exam:
The course is pass/fail based on participation (both lectures and exercises).

Where and when:
The Technical University of Denmark, Lyngby Campus, Building 208, Room 060 - it's in the basement - take the stairs down in the main hallway and turn left. It's the last room on the right, just before the big row of windows. Directions on how to get to DTU (Lyngby) and a map of the buildings are found here: DTU Directions.

The course runs for the duration of Week 2 (Mon 5th of January till Fri 9th of January) from 9:15 till ~16:00 (or wheneven the computer execersis of the day has been completed).
Each day starts with lectures in the morning, and concludes with computer excersices in the afternoon.

Hardware / Software used

The computer exercises can be executed from any internet connected computer (Mac, Linux, Windows) with a modern browser (e.g. FireFox, Safari or a recent version of Internet Explorer - a browser which supports tabs is recommended) and Java installed. Java is used in some exercises to run visualization software. Link: www.java.com.

We recomment the JEdit text editor for use on sequence files, since it is well suited for this purpose and is platform independent. Link: www.jedit.org.

For the protein structure exercise the PyMOL software (also cross-platform) will be used. Main link: www.pymol.org.

Free Student's version:

• Windows version
• Mac version
• Linux version.

Reporting:

Each group has to keep a "log book" with answers to the questions asked in the exercises. After completing an exercise, mail in the report: raz+humanbio@cbs.dtu.dk

The log book should be kept as minimalistic as possible - and it must be written in plain-text. It's strongly recommended to write in a simple text-only editor, such as JEdit introduced on this course.

Answers to the Multiple Alignment exercise
------------------------------------------
Report by: Rasmus Wernersson (v18103)

Question 1
----------
Fasta format file:

>goat_alpha_globin_II
ATGGTGCTGTCTGCCGCCGACAAGTCCAATGTCAAGGCCGCCTGGGGCAAGGTTGGCAGCAACGCTGGAG
CTTATGGCGCAGAGGCTCTGGAGAGGATGTTCCTGAGCTTCCCCACCACCAAGACCTACTTCCCCCACTT
CGACCTGAGCCACGGCTCGGCCCAGGTCAAGGGCCACGGCGAGAAGGTGGCCGCCGCGCTGACCAAAGCG
GTGGGCCACCTGGACGACCTGCCCGGTACTCTGTCTGATCTGAGTGACCTGCACGCCCACAAGCTGCGTG
TGGACCCGGTCAACTTTAAGCTTCTGAGCCACTCCCTGCTGGTGACCCTGGCCTGCCACCACCCCAGTGA
TTTCACCCCCGCGGTCCACGCCTCCCTGGACAAGTTCTTGGCCAACGTGAGCACCGTGCTGACCTCCAAA
TACCGTTAA
>xxx_yyy_qqq
ATAGATAGT ....


Question 2
----------
2a): xxxx yyyy zzzz
2b): ddd jjj uuu

Please note: We collect these answers for two purposes: 1) Assessing participation in the exercises. 2) As a means to improve our teaching, since we get a chance to learn what questions are typically difficult to answer or understand.

Course programme: