Exercise: BLAST

Introduction

In this exercise we will be using BLAST (Basic Local Alignment Search Tool) for searching sequence databases such as GenBank (DNA data) and UniProt (protein). When using BLAST for sequence searches it is of utmost importance to be able to critically evalutate the statistical significance of the results returned.

The BLAST software package is free to use (Open Source) and be be installed on any local system - it's originally written for UNIX type Operating Systems. The package contains both programs for performing the actual sequence searches against preexisting databases (e.g. "blastn" for DNA databases and "blastp" for protein databases), aswell as a tool for creating new databases from stratch (the "fortmatdb" program).

In this exercise we will be using the Web-interface to BLAST hosted by the NCBI. For our purpose there are several advantages to this approach:

• We don't have to mess around with a UNIX command promt.
• NCBI offers direct access to preformatted BLAST databases of all the data that they host:
• GenBank (+ derivates)
• Full Genome database
• Protein database (Both from translated GenBank and UniProt)

It should be noted that running BLAST locally (for example at the super-computer cluster at CBS/DTU) offers much more fine-grained control of DATA and workflow (everything can be scripted/automated) than running BLAST through a web-interface.

Links:

• NCBI BLAST main page: http://www.ncbi.nlm.nih.gov/BLAST/
• Notice: There are links to "Nucleotide BLAST" (including "blastn") and "Protein BLAST" (including "blastp") from this page.
  
  
• NCBI "BLAST information GUIDE"
  

Part 1- Assesing the statistical significance of BLAST hits.

STEP 1 - DNA sequences and BLASTN:

1. Generate 3 DNA seqeunces of length 25bp using the table below.
   
   
   

1 : A
2 : C
3 : G
4 : T

2. QUESTION 1: Report the three sequences in FASTA format (give them short UNIQUE names, e.g. "seq1", "seq2", "seq3").
   
   
3. We now need to do a BLASTN search at NCBI.
   
   
1. Follow the "Nucleotide BLAST" link fro the main BLAST page.
   
   
2. In the section "Program Selection" select the option "Somewhat similar sequences (blastn)"
   
   
3. Choose "Nucletide Collection NR/NT" as the search database. NR is the "Non Redundancy" database, which contains all non-redundant (non-identical) sequences from GenBank and the full Genome databases.
   
   
4. VERY IMPORTANT:
   For this special situation where we BLAST small artificial sequences we need to turn off some the automatics NCBI incorporate when short sequences are detected. Otherwise we'll not be able to see the intended results.
   
   Extend the "Algorithm parameters" section (see the screen shot below) in order to gain access to fine-tuning the options.
   
   • Deselect the "Automaticlly adjust parameters for short input sequences" option
   
   Notice: It's also possible to E-value cutoff ("Expect threshold") and BLASTN "word size" here.
   
   
5. Paste in you three sequences in FASTA format and start the BLAST search.
   
   
   
   
4. Inspect the results.
   
   Notice that NCBI supplies a summary table at the very top of the page, and the individual alignment can be seen further down.
   
   QUESTION 2:
   
   • How big (in basepairs) is the database we used for the BLAST search?
     
     
   • Do you find any sequences that looks like your input sequences (you can paste in a few in your report).
   • What is the typical length of the hits (the alignment length)?
   • What is the typical % identity?
   • In what range is the bit-scores ("max score)?
     
   • Notice: This is conceptually the same as the "alignment score" we have already met in the pairwise alignment exercise.
     
   • What is the range of the E-values?
   
   QUESTION 3:
   
• What is the biological significance of these hits?
  
  
  
5. Now let's try to perform a search against a different database. Open a new window/tab for this - you'll need to compare the results in a moment.
   
   This time choose the "Human genomic plus transcripts" database (and remember to set the Algorithm parameters - same as above), and run the BLAST search.
   
   QUESTION 4:
   
   • Report the same basic statistics as in question 2.
     
   
   QUESTION 5:
   
• All human sequences are also found in the NR database. In case you had any hits against human sequences in the first run:
• Has any of the statistics changed (Bit score, E-value, etc.).
• Why would they change?
  

STEP 2 - Protein sequences and BLASTP:

6. Now it's time to work with a set of protein sequences - generate three sequences of length 25 aa using the table below.
   
   Notice 1: The distribution of aminoacids will be equal (5% prob) and this is different from true biological sequneces - however this is not important for this first part of the exercise.
   
   Notice 2: Please recall from the lecture that the way BLASTP selecets candidate sequences for full Smith-Watermann alignment is different from BLASTN. (BLASTN - a single short (11 bp +) perfect match hit is needed. BLASTP - a pair of "near match" hits of 3 aa with-in a 40 aa window is needed).
   
   QUESTION 6: Report the sequences in FASTA format (once again use short UNIQUE names).
   
   
   

7. Locate the "Protein BLAST" page at NCBI and choose BLASTP as the algorithm to use.
   
   Paste in your sequences in FASTA format, and choose the "NR" database (this is the protein version, consisting of translated CDS'es, UniProt etc).
   
   VERY IMPORTANT: We also need to tweak the parameters this time - in the "Algorithm Parameter" section select BLOSUM62 as the alignment matrix to use and set the "Expect treshold" to 1000 (default: 10) - and DISABLE the "Short sequence" parameters as we did in the DNA search a moment ago - otherwise our carefully tweaked parameters will be ignored.
   
   Perform the BLAST search.
   
   
8. Inspect the results:
   
   QUESTION 7:
   
   
• How big is the database this time?
  
  
• What is the typical length of the alignment and do they contain gaps?
• What is the range of E-values?
• Try to inspect a few of the alignments in details ("+" means similar) - do you find any that look plausible, if we for a moment ignore the length - (you can qoute a few in your report)?
  
  
• If we have used the default E-value cutoff of 10 would any hits have been found?
  
• What returns the most junk - DNA Blast or Protein Blast (take the E-value into account).
  
  

Part 2 - using BLAST to transfer functional information by finding homologs

One of the most common ways to use BLAST as a tool, is in the situation where you have a sequence of unknown function, and want to find out what function it has. Since a large amount of sequence data has been gathered during the years, changes are that an evolutionary related sequence with known function has already been identified. In general such a related sequence is known as a "homolog".

Homo-, Ortho- and Paralogs:

• A Homolog is a general term that describe a sequence that is related by any evolutionary means.
  
  
• An Ortholog ("Ortho" = True) is a sequence that is "the same gene" in a different organism: The sequences shared a single common ancestor sequence, and has now diverged through speciation (e.g. the Alpha globin gene in Human and Mouse).
  
  
• A Paralog arises due to a gene duplication with-in a species. For example Alpha- and Beta-globin are each others paralogs.
  

(Image source: gwLee's blog).

Notice that in both cases it's possible to transfer information, for example information about gene family / protein domains.

We have already touch upon comparison of (potential) evolutionary related sequences in the pairwise alignment exercise. However, this time we do not start out with two sequences we assume are related, but we rather start out with a single sequence ("query sequence") which we will use to search the databases for homologs (we often informally speak of "BLAST hits", when discussing the sequences found).

Lets start out with a sequence that will produce some good hits in the database. The sequence below is a full-legth transcript (mRNA) from a prokaryote. Let's find out what it is.

>Unknown_transcript01
CCACTTGAAACCGTTTTAATCAAAAACGAAGTTGAGAAGATTCAGTCAACTTAACGTTAATATTTGTTTC
CCAATAGGCAAATCTTTCTAACTTTGATACGTTTAAACTACCAGCTTGGACAAGTTGGTATAAAAATGAG
GAGGGAACCGAATGAAGAAACCGTTGGGGAAAATTGTCGCAAGCACCGCACTACTCATTTCTGTTGCTTT
TAGTTCATCGATCGCATCGGCTGCTGAAGAAGCAAAAGAAAAATATTTAATTGGCTTTAATGAGCAGGAA
GCTGTTAGTGAGTTTGTAGAACAAGTAGAGGCAAATGACGAGGTCGCCATTCTCTCTGAGGAAGAGGAAG
TCGAAATTGAATTGCTTCATGAATTTGAAACGATTCCTGTTTTATCCGTTGAGTTAAGCCCAGAAGATGT
GGACGCGCTTGAACTCGATCCAGCGATTTCTTATATTGAAGAGGATGCAGAAGTAACGACAATGGCGCAA
TCAGTGCCATGGGGAATTAGCCGTGTGCAAGCCCCAGCTGCCCATAACCGTGGATTGACAGGTTCTGGTG
TAAAAGTTGCTGTCCTCGATACAGGTATTTCCACTCATCCAGACTTAAATATTCGTGGTGGCGCTAGCTT
TGTACCAGGGGAACCATCCACTCAAGATGGGAATGGGCATGGCACGCATGTGGCCGGGACGATTGCTGCT
TTAAACAATTCGATTGGCGTTCTTGGCGTAGCGCCGAGCGCGGAACTATACGCTGTTAAAGTATTAGGGG
CGAGCGGTTCAGGTTCGGTCAGCTCGATTGCCCAAGGATTGGAATGGGCAGGGAACAATGGCATGCACGT
TGCTAATTTGAGTTTAGGAAGCCCTTCGCCAAGTGCCACACTTGAGCAAGCTGTTAATAGCGCGACTTCT
AGAGGGGTTCTTGTTGTAGCGGCATCTGGGAATTCAGGTGCAGGCTCAATCAGCTATCCGGCCCGTTATG
CGAACGCAATGGCAGTCGGAGCGACTGACCAAAACAACAACCGCGCCAGCTTTTCACAGTATGGCGCAGG
GCTTGACATTGTCGCACCAGGTGTAAACGTGCAGAGCACATACCCAGGTTCAACGTATGCCAGCTTAAAC
GGTACATCGATGGCTACTCCTCATGTTGCAGGTGCAGCAGCCCTTGTTAAACAAAAGAACCCATCTTGGT
CCAATGTACAAATCCGCAATCATCTAAAGAATACGGCAACGAGCTTAGGAAGCACGAACTTGTATGGAAG
CGGACTTGTCAATGCAGAAGCGGCAACACGCTAATCAATAATAATAGGAGCTGTCCCAAAAGGTCATAGA
TAAATGACCTTTTGGGGTGGCTTTTTTACATTTGGATAAAAAAGCACAAAAAAATCGCCTCATCGTTTAA
AATGAAGGTACC

9. Peform a BLAST search in the NR/NT database (BLASTN) using default settings.
   
   QUESTION 8:
   
• Do we get any significant hits?
• What kind of genes (function) do we find?
• How is the distribution of E-values - a broad spectrum from good to bad, or a sharp division into good/bad scores?
  
  
10. Now let's try to do the same at the protein level.
• Find the longest ORF using VirtualRibosome (hint: remeber to search all positive reading frames) and save of copy the sequence in FASTA format.
• BLAST the sequence (BLASTP) against the NR database.
  
  QUESTION 9:
  
• Do we find any conserved protein-domains? (Indicated at the very top of the result page, and during the search). Identifying known protein domains can provide important clues to the function of an unknown protein.
  
  
• Do we find any significant hits? (E-value?)
• Are all the best hits the same category of enzymes?
• How does the distribution of E-values looks compared to the DNA search?
• From what you have seen, what is best for identifying intermediate quality hits - DNA or Protein BLAST?
  
  
11. In the previous section we have been cheating a bit by using a sequence that was already in the database - let's move to the following sequence instead.
    
    The sequence is a DNA fragment fron an unknown non-cultivatable microorganism. It was cloned and sequenced directly from DNA extracted from a soil-sample, and it goes by the poetic name "CLONE12". It was amplified using degenerated PCR primers that target the middle ("core cloning") of the sequence of a group of known enzymes. (I can guarantee this particular sequence is not in the BLAST databases, since I have cloned and sequenced it myself, and it has never been submitted to GenBank).
    
    

12. QUESTION 10:
    Your task is now to find out what kind of enzyme this sequence is likely to encode, using the methods you have learned.
    
    Notice: The sequence is (more or less) in GenBank format and the NCBI BLAST server expects the input to be in FASTA format, or to be "raw" unformatted sequence.
    
    There are two solutions to this:
    
    
    1.  Copy the sequence into a text-editor and manually create a FASTA file ("search and replace" is useful for the reformatting).
       This is the most robust solution: it will always work.
       
       
    2. Hope the creaters of the web-server you're using were kind enough to automatically remove non-DNA letters (paste in ONLY the DNA lines) - this turns out to be the case for both NCBI BLAST and VirtualRibosome, but it cannot be universally relied upon.
    
    Consider the following before you start on solving this task:
    
    • Based on the information given: is the sequence protein-coding?
    • If it is, can you trust it will contain both a START and STOP codon?
    • Do we know if the sequence is sense of anti-sense?
      
    
    Significance: Let's put the criteria for significance at 10^-10 (remeber: the higher the E-value, the worse the significance).
    
    Cover the following in your answer:
    
    • What tool(s) and database will be relevant to use?
      
      
    • Document the results from the different BLAST searches - what works and what does not work?
      
    • You can copy in small snippets of the result to document what you observe.
      
      
    • In conclusion: What kind of enzyme CLONE12? Gather as much evidence as possible.
      
    
    

Part 3 - BLAST'ing Genomes

13. Let's do a small study of the relationship between the histones found in Yeast and in Human (evolutionary distance: ~1-1.5 billion years).
    
    Look up the HTA2 gene in SGD (use the Quick Search box). Notice that a brief description about the function of the gene and it's protein product is displayed (a huge amout of additional information can be found further down the page - much of it Yeast specific).
    
    QUESTION 11: What information is given about the relationship between this gene and the gene "HTA1"?
    
    Browse the page and locate the link to the protein sequence - keep the window open, or save the sequence to a file, we'll need it in a moment.
    
    
    
14. Now return to the NCBI Genome page.
    
    Notice that an overview of the organisms for which genomes are available is shown in a box to the right (section: "Organism-specific") - for each organism the information available is shown using a single letter code ("B" = BLAST). You can use this to open a BLAST page dedicated to that specific genome (you can search both DNA and proteins translated from the genes).
    
    Before we start looking in the human genome, let's find out if we can locate the HTA2 gene in the NCBI version of the Yeast genome.
    
    
    • Go to the BLAST page for Yeast (Click "B").
    • Choose "RefSeq protein" as the database
    • Use the HTA2 protein sequence as query.
      
    
    QUESTION 12:
    
    
    • How many high-confidence hits do we get?
    • Does the hits make sense, from what you have read about HTA2 at the SGD webpage?
      
    
    
    
15. The next step is to search the translated version of the human genome .
    
    Go to the dedicated BLAST page for Human (click "B").
    
    • Choose "RefSeq protein" as the database.
      
      
    • Notice: a larger number of databases are offered compared to Yeast. This is simply due to the fact that the identification of the genes in the human genome is much more troublesome than in Yeast - and therefore a number of alternative interpretations of the genome/proteome is offered. (In Yeast virtually all protein coding genes has been experimentally verfied).
      
      
    • Choose "BLASTP" as the method - and start you search for HTA2 homologs.
    
    QUESTION 13:
    
    
    • How many high-confidence hits are found?
    • These protein originates from a number of genes - but how many UNIQUE genes?
    • Hint: Some of the proteins are iso-forms that originates from alternative splicing (one gene -> multiple iso-forms).
      
      
    Notice: In the BLAST alignments - some parts of the sequences are maked in grey - these are low-complexity regions, that BLAST by default ignores in the comparision.
    
    
16. As the very last thing today, try to disbale the low-complexity filter, and re-run the search (in a new windows/tab):
    
    QUESTION 14: Do we get longer alignments this time?
    
    
17. Concluding remarks: Today we have been using BLAST to find a number of homologues genes (and protein-products). If we want to go even deeper into the analysis of the homologs, the next logical step would be to build a dataset of the full-length versions of the sequences we have found (not just the part found by the local alignment in BLAST).
    
    A further analysis could consist of a series of pairwise alignments (for finding out what is similar/different between pairs of sequences) or a multiple alignment which could form the basis of establishing the evolutionary relationship between the entire set of seqeunces.
    
    BLAST can also be used as way to build a dataset of sequences base on a known "seed" sequence. As we saw in the GenBank exercise, free-text searching in the GenBank can be difficult, and if we for instance wanted to build a dataset of variants of the insulin gene, an easiy way to go around this would be to BLAST the normal version of the insulin against the sequence database of choice, and pick the best matching hits from here.