Events News Research CBS CBS Publications Bioinformatics
Staff Contact About Internal CBS CBS Other

Kursusprogram, forår 2010 - #27611


Undervisere:

Hælpelærere:

Indhold:
I dette kursus er der lagt en stor vægt på praktisk anvendelse af de bioinformatiske værktøjer. En typisk lektion vil blive indledt med en teoretisk gennemgang af dagens emne (incl. nogle mindre øvelser/gruppearbejde) på en lille times tid, og resten af tiden vil blive brugt til praktiske øvelser på computer.

Pensum:
Udleverede noter og øvelsesmateriale: Der en ikke en formel lærebog - der vil løbende blive udleveret kompendiemateriale - typisk i form af PDF filer på hjemmesiden.

Computere
I skal SELV medbringe bærbare computere der kan kobles til DTU's trådløse netværk. Typen af computer/Operativ System er ikke vigtigt - Windows, Mac og Linux vil alle virke fint. Software: En moderne Internet Browser (fx. Internet Explorer, FireFox eller Safari) og JAVA. JAVA kan hentes gratis her: www.java.com - ofte vil det allerede være installeret på din computer. I kurset vil vi flere gange bruge JEdit til at kigge på tekst-baserede sekvensfiler - du kan med fordel installere den før første kursus-gang (gratis program): www.jedit.org.

Hvor og hvornår:
Kurset består af forelæsning + efterfølgende øvelser. Forelæsninger afholdes tirsdage fra 13:00-14:00 (circa) i bygning 208, auditorium 51. Øvelserne afholdes efterfølgende i rum 112 & 118 i bygn. 210.

Første undervisningsgang er tirsdag den 2. februar.


Afleveringer:
Som træning til den computer-baserede eksamen, skal hver gruppe skrive en "log bog" med svar på de spøgsmål der stilles i øvelserne (man må gerne skrive på dansk selvom teksten i øvelserne er på engelsk). Efter øvelsen skal I upload'e jeres svar til CampusNet (Kursus 27611 -> Afleveringer).

I kan med fordel bruge en helt almindelig tekst-editor (fx. JEdit som vi introducerer første dag), og ikke bruge en masse kræfter på fancy formatering. Det vigtige er at adskille de enkelt svar, så det er let at læse. Et eksempel kunne være:

Svar på Multiple Alignment øvelse
---------------------------------
Af: Rasmus Wernersson (v18013)

Spørgsmål 1
-----------
Fasta fil:

>goat_alpha_globin_II
ATGGTGCTGTCTGCCGCCGACAAGTCCAATGTCAAGGCCGCCTGGGGCAAGGTTGGCAGCAACGCTGGAG
CTTATGGCGCAGAGGCTCTGGAGAGGATGTTCCTGAGCTTCCCCACCACCAAGACCTACTTCCCCCACTT
CGACCTGAGCCACGGCTCGGCCCAGGTCAAGGGCCACGGCGAGAAGGTGGCCGCCGCGCTGACCAAAGCG
GTGGGCCACCTGGACGACCTGCCCGGTACTCTGTCTGATCTGAGTGACCTGCACGCCCACAAGCTGCGTG
TGGACCCGGTCAACTTTAAGCTTCTGAGCCACTCCCTGCTGGTGACCCTGGCCTGCCACCACCCCAGTGA
TTTCACCCCCGCGGTCCACGCCTCCCTGGACAAGTTCTTGGCCAACGTGAGCACCGTGCTGACCTCCAAA
TACCGTTAA
>xxx_yyy_qqq
ATAGATAGT ....


Spørgsmål 2
-----------
2a): xxxx yyyy zzzz
2b): ddd jjj uuu

NB: Afleveringerne her ikke nogen inflydelse på jeres karakter - det er rent øvelse i brug af det system vi også skal bruge til eksamen.

Løbende evalutering:
http://evaluering.win.dtu.dk/


Lektionsplan:

Tirsdag 2/2

Introduktion til kurset, Evolution. - Rasmus Wernersson.

Pensum: Brief Introduction to Evolutionary Theory - Skrevet af Anders Gorm Pedersen.
Slides: ( på CampusNet - under "fildeling")

Øvelse: 1) JEdit (svar: txt) - 2) Taxonomi databaser (svar: txt).

ADVANCERET EMNE (Ej pensum):
Textfiler på binært niveau (Video forelæsning, ~20mb, mpeg4 - Indlæst af Rasmus Wernersson, 2010)

Baggrundsmateriale:
"Hvad er Bioinformatik?" - oversigtsartikel (PDF).

Tirsdag 9/2

Biologisk information, DNA struktur og sekventering, søgning i Genbank - Rasmus Wernersson.

Pensum: DNA sequencing tutorial - kilde: IDT Tech Vault
Udleveret materiale: "Base-calling" øvelse [PDF], GenBank + FASTA format [PDF]
Slides: på CampusNet - under "fildeling")

Øvelse: Brug af GenBank databasen (svar: txt).

Baggrundsmateriale:
mRNA splicing (YouTube).
Oversigt over eukaryot gen-struktur (PDF).

Tirsdag 16/2

Proteiner: data og databaser - Henrik Nielsen.

Pensum: Virtual Ribosome - software artikel.
Slides: PowerPoint, PDF
Udleveret materiale: Protein, sekvens og strukturniveauer [PDF]

Øvelse: Translation (svar) & Proteindatabaser (svar).

Baggrundsmateriale:
Aminosyrer og Proteiner - Kort videoforlæsning (16 min) med en genopfriskning af de vigtigste facts ang. aminosyrer og proteiner (Indlæst af Thomas Nordahl Petersen, 2010).

Tirsdag 23/2

Parvis alignment - Rasmus Wernersson.

Pensum: Side 35-55 i Immunological Bioinformatics (PDF - på CampusNet).

Slides: (På CampusNet).

Øvelse: Parvis alignment - svar til øvelsen: Parvis alignment svar

ADVANCERET EMNE (Ej pensum):
 Video-klip: (Optaget i 2008): Detaljeret gennemgang af Dynamisk Programmering.
Mac/Windows (QuickTime): Mpeg4 (6.4 mb) - iPod: m4v (10 mb)
Hvis din browser tilføjer .txt til filens navn, så fjern dette så den igen hedder .mp4 eller .m4v

Tirsdag 2/3

Protein 3D struktur - Thomas Blicher / Thomas Nordahl Petersen

Pensum: Protein Structure (Wikipedia - frosset version).
Link til "Live" version: http://en.wikipedia.org/wiki/Protein_structure

 Forelæsning Online video forelæsning, Thomas Blicher
Slides: På CampusNet
Øvelse: Protein Structure Practical - af Anne Mølgaard og Thomas Blicher.
-> RETTELSE: - I skal bruge uniprot.org og ikke "Expasy" til at søge efter proteiner.
Svar til øvelsen: På CampusNet.

Tirsdag 9/3

Opsamlende computerøvelse på de emner der er gennemgået indtil videre - Daniel Aaen Hansen & Rasmus Wernersson (øvelse af Thomas Salhøj Rask og Henrik Nielsen).

Slides: På CampusNet

Øvelse: Malaria vaccine udvikling.
Svar til øvelsen: Malaria vaccine svar

Tirsdag 16/3

BLAST: Introduktion til BLAST - Rasmus Wernersson.

Pensum: sektion 3.2.5 -> 3.3 (dvs. side 47 - 52) i Immunological Bioinformatics (PDF - på CampusNet).

Slides: (På CampusNet).
 Video-PodCast: Forelæsning om BLAST - FRA 2008.
Mac/Windows (QuickTime): PodCast_BLAST_1024x768.mov (14 mb) - iPod: PodCast_BLAST_iPod.mov (13 mb)

Øvelse: BLAST - Svar til øvelsen: Blast svar

Tirsdag 23/3

Multiple alignments - Rasmus Wernersson/Anders Gorm Pedersen

Pensum: RevTrans (artikel, PDF)
Handout: Lokalisering af CDS navne i GenBank ( PDF)
Slides: På CampusNet.

Øvelse: Multiple Alignment (NYT LINK) - Svar : Multiple Alignment svar


Påskeferie

Tirsdag 6/4

Fylogenetiske træer - Rasmus Wernersson / Anders Gorm Pedersen.

Pensum: Introduction to Treebuilding (PDF på Campusnet). Evolutionary trees (minus afsnittet "How to reconstruct an evolutionary tree").
Udleveret materiale: handout øvelse Rekonstruktion af afstandstræ
Slides: På CampusNet.
Øvelse:: "The Phylogeny of HIV" (Svar på CampusNet)

Tirsdag 13/4

LOGO'er og vægt-matricer - Morten Nielsen / Thomas Nordal.

Pensum: Side 68-80 i Immunological Bioinformatics (PDF - på CampusNet).

Supplerende pensum: Konstrution af Logo plots - Hand out (Rasmus Wernersson).
Handouts til forelæsning: "How to construct sequence logos". "Answers"
Handouts til forelæsning: "How to estimate pseudo frequencies". "Answers"

Slides: På CampusNet.
Øvelse:: "Sequence logos and weight matrices" Answers:: Answers to exercise

Tirsdag 20/4

PSI-BLAST - Morten Nielsen

Pensum: Samme som sidste uge.
Slides: På CampusNet.
Handouts til forelaesning: Alignment using sequence profiles
Øvelse: PSI-BLAST

Tirsdag 27/4

Introduktion til forudsigelsesmetoder - Morten Nielsen / Claus Lundegaard.

Slides: På CampusNet.
Handouts til forelæsning: Prediction using artifial neural networks.
Svar: Answers to Prediction using artifial neural networks.


Øvelse: Training of a bioinformatics prediction method.

Tirsdag 4/5

Gamle eksmenssæt - Rasmus Wernersson mfl.

Sidste års eksamen:
Sommereksamen 2009 - online materiale - Sommereksamen 2009 - trykt sæt (PDF på CampusNet). BEMÆRK: Vi skal arbejde med opgave 1-5.
SVAR: På CampusNet (Fildeling -> Gamle eksamenssæt). .

Tirsdag 18/5

Spørgetime - Rasmus Wernersson mfl.



Torsdag 27/5:

EKSAMEN 2010:

NB: der åbnes først for adgang fra klokken 15:00 den 27/5 2010.

Genopfrisk (reload - ofte F5 under Windows) denne side for at se link'et til eksamensopgaverne

SOMMEREKSAMEN 2010 SOMMEREKSAMEN 2010


Tjekliste til computere

Software / opsætnings Tjekliste (PDF).

Link samling:

Links til de værktøjer og databaser vi har brugt i kurset: Link samling

Gamle eksamenssæt:

Gamle eksamenssæt + svar findes på CampusNet: Fildeling -> Gamle eksamenssæt

Har du brug for at genopfriske din biologiske viden? Kig på disse online ressourcer:

Genomics 101       CSH: DNA from the beginning