INSTRUCTIONS for using the NetPlantGene mail server: In order to use the mail server for prediction on nucleotide sequences: 1) Prepare a text file including one or more sequences. The sequences must be preceded by a line starting by the symbol > followed by a name (identifyer) of the sequence. There must be at least one character at each line of each sequence. The sequences must be submitted using the one letter abbreviations for the nucleotides: `acgtACGT'. N.B. Other characters will be accepted, but not encoded in the network window, when making the prediction. Example: Create a text file: `sequence.txt' using an editor, the syntax of the file may look like this: >seq_name1 example TTCTCGTAGGTGGCATTCAATTTGCTACTGCTCAATTGCCCCTTCTTGAGCTGATGGATTGTGGCATG ACTGTCTCTGATCCCAACTCAGATAATCCGACCTTTGTAGAGAATCCAAGTCCACATAAAACACCAGG CTACAATCAAAAGATGTTTATCAAACATAAACGGCTGAAGAAACTTAGTTTGTGGGGATGTCTCCAGT . . TTCTCGTAGGTGGCATTCAATTTGCTACTGCTCAATTGCCCCTTCTTGAGCTGATGGATTGTGGCATG ACATAAACGGCTGAAGAAACTTAGTTTGTGGGGATGTCTCCAGTTTGGACGTGAGATTCCTC >seq_name2 example GCATCAGGATGTCAAGGCCTATTGACCGGAGCTATCCGAAAACAGGTAATCCCTTGAACATCTGTGAT GTCTTAGACATGTGATTAGTAAAAAACAATCTGTTTGAGTCACACCCAACCCAAACTCTTAAGAAGCG TCTCCTTATTTGTGATAGGTTTCTGAAAACTTCTCGGCTGGTGAGAACCATATGCCACGGAAACGCTT . . GGCTGATGCATCTAAAAGGATTCAAGCTTTACCTTC 2) Mail the text file to netplantgene@cbs.dtu.dk: In the UNIX environment you may mail the text file `sequence.txt' to netplantgene@cbs.dtu.dk by typing: mail netplantgene@cbs.dtu.dk < sequence.txt 3) You will receive a mail containing the prediction, or possibly error messages from the server. If the file contains the word `help', this help file will be returned. Response time depends on system load.