Events News Research CBS CBS Publications Bioinformatics
Staff Contact About Internal CBS CBS Other

EasyGene Usage Instructions



1. Specify the input sequences

Input sequences must be prokaryotic DNA sequences in FASTA format.

The first line in the FASTA format has a ">" followed by whatever name one would like the sequence to have.
The second and subsequent lines are sequence symbols (e.g. DNA bases) with no more than 80 on each line.

Example of an input file with two FASTA sequences:

>gb|AE000783|AE000783
TAAATATAATTTAATAGTATAAAAAAAATTAAATCAAATTAATAATAGTTTAAAAAACTGTTTGTATAAT ATAATATTATTATATATAATATTAAGCAACTACTATGATACTAATGAAGTATAGTGCTATTTTATTAATA TGTAGCGTTAATTTATTTTGTTTTCAAAATAAATTAACTACTTCTCGATGGGAATTCCCTAAAGAAGATT TAATTAAAAAAAAAATAAAAATAGGCATAATTTACCATAATTACATAAATTCTATCTTTTACAATGAAAA TTATAAATACATTGCCTTTATCGGAATATTGACATCTTATAATGAATGGATTGAAATACAATTTAGCCCC ATAAATTTTTTTACTATCCCAACAAATAAAGATTTTATTTCAAATACTTATTTCAATTTAGCTTTCACTA TTTACATTACCAAGTATTCAATTTTAACTGATACACTTGCTATAAAATTTTTTAT
>AE006641-838-2101 24 0 24 THID_STRCO
CCCAGCTAAACTAACCTAAAATTAAAATCTCTCATCGATATAATTAAATTGTGCACACTAGACCAGTAGT TGCCACAATAGCTGGGAGTGACAGTGGAGGAGGTGCTGGATTACAGGCTGATCTAAAGACGTTTAGCGCA TTAGGAGTTTTTGGTACAACAATAATAACCGGTTTAACAGCACAGAATACAAGAACAGTTACAAAAGTAT TAGAGATACCATTAGATTTCATTGAAGCTCAGTTTGATGCGGTTTGCCTAGATTTACATCCAACTCACGC CAAAACTGGAATGTTAGCTTCTGGTAAAGTGGTAGAACTTGTACTGAGAAAAATTAGAGAGTATAACATA AAACTAGTTTTAGATCCAGTGATGGTTGCGAAATCTGGATCATTATTGGTAACAGAGGATATCTCGGAGC AAATAAAAAAGGCGATGAAGGAGGCCATAATATCTACTCCAAACAGATATGAAGCTGAGATAATAAATAA GACAAAGATTAATAGTCAAGATGATGTTATAAAAGCGGCAAGGGAAATTTATTCTAAGTATGG

The allowed alphabet (not case sensitive) is as follows:

A C G T

All other symbols will be converted to N before processing. The sequences can be input in the following two ways:

  • Paste one or more DNA sequences in FASTA format into the upper window of the main server page.

  • Select a FASTA file on your local disk, either by typing the file name into the lower window or by browsing the disk.

Both ways can be employed at the same time: all the specified sequences will be processed.


2. Select the output parameters

By default the server only shows the highest scoring start codons. If alternative start codons are wanted, select a higher value than the default zero in the "start codon leniency" option. The higher the value, the more alternative start codons will show up.

By default the server only shows gene predictions with R-values below R=2. If more (and less certain!) predictions are wanted, one may enter a higher R-value in the specified field. For small genes especially, it may be a good idea to consider R-values up to around R=60.


3. Submit the job

Click on the "Submit" button. The status of your job (either 'queued' or 'running') will be displayed and constantly updated until it terminates and the server output appears in the browser window.

At any time during the wait you may enter your e-mail address and simply leave the window. Your job will continue; you will be notified by e-mail when it has terminated. The e-mail message will contain the URL under which the results are stored; they will remain on the server for 24 hours for you to collect them.

NOTE: The time taken to process an entire prokaryotic genome ranges from about 40 seconds to 10 minutes depending on the size of the genome and the load on the server.




GETTING HELP

Scientific problems:        Technical problems: