Events News Research CBS CBS Publications Bioinformatics
Staff Contact About Internal CBS CBS Other

MatrixPlot 1.2: Align format for nucleotides

Introduction Data format User matrix Mutual Nucl Mutual Prot Dist matrix

For the align format each line has to begin with a ">" followed by the sequence. All sequences must have the same length, and may consist of upper and/or lower case letters. The letters for nucleotide sequences are A, C, G , U, T and ``-'' to indicate gaps. The letters are always to be specified to the Inform program. (The sequences here are from Tuerk et. al. PNAS 89, pp 6988-6992, 1992.)


> CCAGAGGCCCAACUGGUAAACGGGC
> CCG-AAGCUCAACGGGAUAAUGAGC
> CCG-AAGCCGAACGGGAAAACCGGC
> CC-CAAGCGC-AGGGGAGAA-GCGC
> CCG-ACGCCA-ACGGGAGAA-UGGC
> CCGUUUUCAG-UCGGGAAAAACUGA
> CCGUUACUCC-UCGGGAUAAAGGAG
> CCGUAAGAGG-ACGGGAUAAACCUC
> CCG-UAGGAG-GCGGGAUAU-CUCC
> CCG--UGCCG-GCGGGAUAU-CGGC
> CCG-AACUCG-ACGGGAUAA-CGAG
> CCG--ACUCG--CGGGAUAA-CGAG




GETTING HELP

Scientific problems:        Technical problems: