Events News Research CBS CBS Publications Bioinformatics
Staff Contact About Internal CBS CBS Other

MatrixPlot 1.2: Export user data

Introduction Data format User matrix Mutual Nucl Mutual Prot Dist matrix

Any web application that produces an mp file can be submitted to MatrixPlot. All the user needs to see is a submit button. The file and options can be taken care of by defining hidden variables. Here is an example, where the mp file http://www.cbs.dtu.dk/services/MatrixPlot-1.2/dataformat/mtypeComp.mp can be submitted directly to the MatrixPlot user page by pushing the submit button here


To export the alignment file http://www.cbs.dtu.dk/services/MatrixPlot-1.2/dataformat/nt.align push the button

However, even PDB files can also be submitted directly. For example, the distance matrix for PDB entry 2gd1 can be displayed by pushing this button: The web page for 2gd1 is http://www.rcsb.org/pdb/cgi/explore.cgi?job=download&pdbId=2GD1&page=&pid=14109927207099&opt=show&format=PDB&pre=1

For the html code for the mp button all user matrix options are included. For the lines in blue the value can be changed by the user. Changes to include PDB files and sequence alignment files are described further down.
---------------------------------


<FORM ACTION="http://www.cbs.dtu.dk/cgi-bin/webface" METHOD="POST">

<INPUT TYPE=HIDDEN NAME=configfile
    VALUE="/usr/opt/www/pub/CBS/services/MatrixPlot-1.2/matrixplot.cf">
<INPUT TYPE=HIDDEN NAME=plotmode VALUE="regular">
<TYPE=HIDDEN NAME=matrixtype VALUE="umat">


<input type=submit value="Export the mp file">
<INPUT TYPE=HIDDEN NAME=wwwheadline VALUE="Exported data">

<!--  The http address to the mp file  -->
<!--  Extension .gz and .Z are allowed -->
<INPUT TYPE=HIDDEN NAME="dataurl"

VALUE="http://www.cbs.dtu.dk/services/MatrixPlot-1.2/dataformat/mtypeComp.mp">

<!-- Color scale (interval R G B) -->
<INPUT TYPE=HIDDEN NAME=scalefile
VALUE="0.0  0.80 0.80 0.80
 0.2  0.75 0.80 0.80
 0.3  0.65 0.70 0.80
 0.4  0.50 0.55 0.80
 0.5  0.45 0.50 0.90
 0.7  0.35 0.40 0.90
 0.9  0.30 0.35 1.00
 1.1  0.20 0.25 1.00
 max  0.10 0.15 1.00
">

<!-- title -->
<INPUT TYPE=HIDDEN NAME="title"  VALUE="Exported data">

<!-- Title: size toffsetx toffsety -->
<INPUT TYPE=HIDDEN NAME="tsizexy"  VALUE="20 35 275">

<!--  Color scale out  -->
<INPUT TYPE=HIDDEN NAME=colorscale  VALUE="y">

<!-- Colorgrain  -->
<INPUT TYPE=HIDDEN NAME=colorgrain  VALUE="n">

<!-- Spacing  -->
<INPUT TYPE=HIDDEN NAME="spacing"  VALUE="0.05">

<!-- Color: size xcoloff ycoloff  -->
<INPUT TYPE=HIDDEN NAME="csizexy"  VALUE="15 35 50">

<!--  Grid: thickness xgridsize ygridsize -->
<INPUT TYPE=HIDDEN NAME="gridsizexy"  VALUE="0.05 0 0">

<!-- Show max value  -->
<INPUT TYPE=HIDDEN NAME=maxout  VALUE="y">

<!-- Position numbers: size xnumpos ynumpos  -->
<INPUT TYPE=HIDDEN NAME="numsizexy"  VALUE="15 2 2">

<!-- Bar of first assignment col:   -->
<INPUT TYPE=HIDDEN NAME=bars  VALUE="n">

<!-- Properties: barthick xbarpos ybarpos   -->
<INPUT TYPE=HIDDEN NAME="barwxy"  VALUE="5 15 15">

<!--  Letters of first assignment col:  -->
<INPUT TYPE=HIDDEN NAME=stringout  VALUE="n">

<!--  Properties: scale xbarpos ybarpos -->
<INPUT TYPE=HIDDEN NAME="stringsxy"  VALUE="1 15 15">

<!-- Bar of second assignment col  -->
<INPUT TYPE=HIDDEN NAME=bars2  VALUE="n">

<!-- Properties: barthick2 xbarpos2 ybarpos2  -->
<INPUT TYPE=HIDDEN NAME="bar2wxy"  VALUE="5 15 15">

<!--  Letters of second assignment col: -->
<INPUT TYPE=HIDDEN NAME=string2out  VALUE="n">

<!-- Properties: scale xbarpos2 ybarpos2   -->
<INPUT TYPE=HIDDEN NAME="string2sxy"  VALUE="1 15 15">

<!-- The bars and letters can be replaced by one entire text string. -->
<!-- Read all cols as one string (you can have more than two cols).  -->
<INPUT TYPE=HIDDEN NAME=onestring  VALUE="n">

<!-- Show sequence information profile:  -->
<INPUT TYPE=HIDDEN NAME=seqlogo  VALUE="n">

<!-- Move baseline of info profile when having gaps in alignment:  -->
<INPUT TYPE=HIDDEN NAME=neg  VALUE="n">

<!-- Include gap profile (usegaps):   -->
<INPUT TYPE=HIDDEN NAME=usegaps  VALUE="y">

<!-- Complementary matrix elements (cout):  -->
<INPUT TYPE=HIDDEN NAME=cout  VALUE="n">

<!-- Reverse horizontal direction (xreverse):  -->
<INPUT TYPE=HIDDEN NAME=xreverse  VALUE="n">

<!-- Reverse vertical direction (yreverse):   -->
<INPUT TYPE=HIDDEN NAME=yreverse  VALUE="n">

</form>

---------------------------------

The mp file data can be submitted alternatively, by writing all the data in the html file itself. Then replace the mp file section above with:

<INPUT TYPE=HIDDEN NAME=mpUserfile
VALUE="R  1 25 1 25
 .    .   .   .
 .    .   .   .
 .    .   .   .
 M   15  10   0.000000
 M   16  10   0.000000
 M   17  10   0.143391
 M   18  10   0.380945
 M   19  10   0.000000
 M   20  10   0.146535
 M   21  10   0.258617
 M   22  10   1.280672 
 M   23  10   0.309715
 M   24  10   0.205956
 M   25  10   0.114005
">

As illustrated above alignment files, PDB or column files can be submitted using http links. The changes in the html code when submitting these files are as follows (for completeness, files within the form are included rather than URL links). To include sequence alignments the options to Inform should be included and value of "matrixtype" changed. The following changes should be made:
<INPUT TYPE=HIDDEN NAME=matrixtype VALUE="nucl">
<INPUT TYPE=HIDDEN NAME=mtype VALUE="2">
<INPUT TYPE=HIDDEN NAME=diagout VALUE="n">
<INPUT TYPE=HIDDEN NAME=bp VALUE="n">
<INPUT TYPE=HIDDEN NAME="alfile" VALUE="A C G UT -">
<INPUT TYPE=HIDDEN NAME=backdist
 VALUE="A    C    G   UT -
     0.25 0.25 0.25 0.25 1
">
<INPUT TYPE=HIDDEN NAME=matrix
 VALUE="   A  C  G  UT -
 A 0  0  0  1  0
 C 0  0  1  0  0
 G 0  1  0  1  0
UT 1  0  1  0  0
 - 0  0  0  0  0
">

<-- Any of the formats align, fasta or msf can be used --">
<INPUT TYPE=HIDDEN NAME=alignment
VALUE="> CCAGAGGCCCAACUGGUAAACGGGC
> CCG-AAGCUCAACGGGAUAAUGAGC
> CCG-AAGCCGAACGGGAAAACCGGC
> CC-CAAGCGC-AGGGGAGAA-GCGC
> CCG-ACGCCA-ACGGGAGAA-UGGC
> CCGUUUUCAG-UCGGGAAAAACUGA
> CCGUUACUCC-UCGGGAUAAAGGAG
> CCGUAAGAGG-ACGGGAUAAACCUC
> CCG-UAGGAG-GCGGGAUAU-CUCC
> CCG--UGCCG-GCGGGAUAU-CGGC
> CCG-AACUCG-ACGGGAUAA-CGAG
> CCG--ACUCG--CGGGAUAA-CGAG
">
Similarly for protein sequence alignment. The relevant Inform options can be included and the value of "matrixtype" should be "prot". When using distance matrices the value of "matrixtype" should be "dmat". The changes to perform when including 3D coordinates in terms of (1) a PDB entry name, (2) a PDB file, or (3) a column file are:
<INPUT TYPE=HIDDEN NAME=matrixtype VALUE="dmat">

<-- case (1) only pdb entry name and chain --">
<INPUT TYPE=HIDDEN NAME=pdbentry VALUE="4mt2">
<INPUT TYPE=HIDDEN NAME=pdbchain VALUE="">

<-- case (2) and (3) pdb file or column file --">
<INPUT TYPE=HIDDEN NAME=pdbfile
VALUE=" (PDB or COLUMN FILE STARTS HERE)
 .   .   .   .   .
 .   .   .   .   .
 .   .   .   .   .
(PDB or COLUMN FILE ENDS HERE)
">

<-- case (3) options to column file --">
<INPUT TYPE=HIDDEN NAME="xcol" VALUE="5">
<INPUT TYPE=HIDDEN NAME="ycol" VALUE="6">
<INPUT TYPE=HIDDEN NAME="zcol" VALUE="7">
<INPUT TYPE=HIDDEN NAME="acol" VALUE="2">
<INPUT TYPE=HIDDEN NAME="scol" VALUE="4">

WARNING
In general, when including files as html links they should only contain the relevant text. Web pages containing more than the data, such as the PDB page, will most likely work anyway as the program recognize specific fields in the file. When using an alignment file it will probably only work if that file contains nothing but the alignment in one of the valid formats.



GETTING HELP

Scientific problems:        Technical problems: