Services are gradually being migrated to https://services.healthtech.dtu.dk/.
In the near future, cbs.dtu.dk will be retired. Please try out the new site.

Instructions



In order to use the NetAspGene server for splice site prediction in Aspergillus DNA:
  1. Paste Fasta sequence or select a local Fasta file by pressing the 'Choose File' bottom. Remember to make the correct file selection mask (like *.fasta). A fasta file is an ascii file with the sequence, as shown below, and should contain only one sequence.
  2. The fasta file must be submitted using the one letter abbreviations for the nucleotides: `acgtuACGTU', 'N' or "X" for unknown.
  3. The sequence must be more than 200 (preferably more than 250) and less than 80.000 nucleotides long. Shorter sequences are accepted, but the prediction will be suboptimal. Long sequences may provoke a time out.
  4. Press the "Submit" button.
  5. A WWW page will return the results as the prediction finishes. Response time depends on system load.

EXAMPLE FASTA FILE

>sequenceident
TCCCTTCCATCCATTGCACGATGAGCTCTCTTCGTTTCGCTCGCTCTGCTCTCAGGGCTC
GTCCCTCTGCTCTCCGCGTTCCTCTCCAGCGCAGAGGTTACGCTGAGGCTGTGTCGGACA
AGATCAAGCTTTCTCTGGCCCTTCCTCACCAGGTAAGATCCGAGATAACTGAACGCACCC
TTTTCGTCTTAATAGGTTGGAAACTAATATGAGAACTTTGCAACAGACTATCTTCAAGTC
GGCCGACGTGTACGTGACGACCAACTCCTCCCTCGTTCACGATCGGCAATTCTGAAGATG
GCTTGAATGCGTACTGATGACCTCCCCCTACAGTGTCCAGGTCAACATCCCCGCCGAGTC
CGGAGAAATGGGTGTCCTCGCCAACCACGTTCCTTCCATTGAGCAGCTGAAGCCTGGTCT
TGTTGAGATCGTTGAGGAGAGTGGTGCCAACAAGAAGTTCTTCCGTACGTCCGGACAACC
CCGCTGAGCTTTGCGCTGCGATATCGTGGGACCACGAAGATGTCGCATTGCTTCCTATAG
CATCGCACTAACGAGTCTGCGTTCTTCAGTTTCTGGTGGTTTCGCCGTCGTTCAGCCTGA
CTCTGCTCTGAGCATCAACGCCGTGGAGGCCTACCCCCTCGAGGACTTCAGCGCCGATGT
AAGTTGTGGAAACGAAGAAAATGTCTTGATATACTTTTTTGACCCAATCTTTCAATTACA
GGCTGTCAAATCCCAGATCGCCGAGGCCCAGAAGATTGCCAATGGTAGTGGCAGTGAGCA
GGACATTGCTGAGGCTAAGATTGAGCTCGAGGTAGGTCAACCACGAACGCGCTAGCACGA
GGCTATACTCAATTGCTAATGTTGTCACAGGTTCTGGAGACCCTGCAAGCCGTCCTGAAA
TAGATACCTGATGTACATAACCACTCGCGATTGCAATTCTGAACTTGTAGAATTATAACA
ATTCTCCGGCA



GETTING HELP

Scientific problems:        Technical problems: