Events News Research CBS CBS Publications Bioinformatics
Staff Contact About Internal CBS CBS Other

FASTA format example


A file in FASTA format. Two entries (both from GenBank) are shown in this example. The current release of the NetGene2 WWW server, however, will only work with files containing one sequence.

Use the mail server to submit multiple sequences.

>HSBGPG Human gene for bone gla protein (BGP)
GGCAGATTCCCCCTAGACCCGCCCGCACCATGGTCAGGCATGCCCCTCCTCATCGCTGGGCACAGCCCAGAGGGT
ATAAACAGTGCTGGAGGCTGGCGGGGCAGGCCAGCTGAGTCCTGAGCAGCAGCCCAGCGCAGCCACCGAGACACC
ATGAGAGCCCTCACACTCCTCGCCCTATTGGCCCTGGCCGCACTTTGCATCGCTGGCCAGGCAGGTGAGTGCCCC
CACCTCCCCTCAGGCCGCATTGCAGTGGGGGCTGAGAGGAGGAAGCACCATGGCCCACCTCTTCTCACCCCTTTG
GCTGGCAGTCCCTTTGCAGTCTAACCACCTTGTTGCAGGCTCAATCCATTTGCCCCAGCTCTGCCCTTGCAGAGG
GAGAGGAGGGAAGAGCAAGCTGCCCGAGACGCAGGGGAAGGAGGATGAGGGCCCTGGGGATGAGCTGGGGTGAAC
CAGGCTCCCTTTCCTTTGCAGGTGCGAAGCCCAGCGGTGCAGAGTCCAGCAAAGGTGCAGGTATGAGGATGGACC
TGATGGGTTCCTGGACCCTCCCCTCTCACCCTGGTCCCTCAGTCTCATTCCCCCACTCCTGCCACCTCCTGTCTG
GCCATCAGGAAGGCCAGCCTGCTCCCCACCTGATCCTCCCAAACCCAGAGCCACCTGATGCCTGCCCCTCTGCTC
CACAGCCTTTGTGTCCAAGCAGGAGGGCAGCGAGGTAGTGAAGAGACCCAGGCGCTACCTGTATCAATGGCTGGG
GTGAGAGAAAAGGCAGAGCTGGGCCAAGGCCCTGCCTCTCCGGGATGGTCTGTGGGGGAGCTGCAGCAGGGAGTG
GCCTCTCTGGGTTGTGGTGGGGGTACAGGCAGCCTGCCCTGGTGGGCACCCTGGAGCCCCATGTGTAGGGAGAGG
AGGGATGGGCATTTTGCACGGGGGCTGATGCCACCACGTCGGGTGTCTCAGAGCCCCAGTCCCCTACCCGGATCC
CCTGGAGCCCAGGAGGGAGGTGTGTGAGCTCAATCCGGACTGTGACGAGTTGGCTGACCACATCGGCTTTCAGGA
GGCCTATCGGCGCTTCTACGGCCCGGTCTAGGGTGTCGCTCTGCTGGCCTGGCCGGCAACCCCAGTTCTGCTCCT
CTCCAGGCACCCTTCTTTCCTCTTCCCCTTGCCCTTGCCCTGACCTCCCAGCCCTATGGATGTGGGGTCCCCATC
ATCCCAGCTGCTCCCAAATAAACTCCAGAAG
>HSGLTH1 Human theta 1-globin gene
CCACTGCACTCACCGCACCCGGCCAATTTTTGTGTTTTTAGTAGAGACTAAATACCATATAGTGAACACCTAAGA
CGGGGGGCCTTGGATCCAGGGCGATTCAGAGGGCCCCGGTCGGAGCTGTCGGAGATTGAGCGCGCGCGGTCCCGG
GATCTCCGACGAGGCCCTGGACCCCCGGGCGGCGAAGCTGCGGCGCGGCGCCCCCTGGAGGCCGCGGGACCCCTG
GCCGGTCCGCGCAGGCGCAGCGGGGTCGCAGGGCGCGGCGGGTTCCAGCGCGGGGATGGCGCTGTCCGCGGAGGA
CCGGGCGCTGGTGCGCGCCCTGTGGAAGAAGCTGGGCAGCAACGTCGGCGTCTACACGACAGAGGCCCTGGAAAG
GTGCGGCAGGCTGGGCGCCCCCGCCCCCAGGGGCCCTCCCTCCCCAAGCCCCCCGGACGCGCCTCACCCACGTTC
CTCTCGCAGGACCTTCCTGGCTTTCCCCGCCACGAAGACCTACTTCTCCCACCTGGACCTGAGCCCCGGCTCCTC
ACAAGTCAGAGCCCACGGCCAGAAGGTGGCGGACGCGCTGAGCCTCGCCGTGGAGCGCCTGGACGACCTACCCCA
CGCGCTGTCCGCGCTGAGCCACCTGCACGCGTGCCAGCTGCGAGTGGACCCGGCCAGCTTCCAGGTGAGCGGCTG
CCGTGCTGGGCCCCTGTCCCCGGGAGGGCCCCGGCGGGGTGGGTGCGGGGGGCGTGCGGGGCGGGTGCAGGCGAG
TGAGCCTTGAGCGCTCGCCGCAGCTCCTGGGCCACTGCCTGCTGGTAACCCTCGCCCGGCACTACCCCGGAGACT
TCAGCCCCGCGCTGCAGGCGTCGCTGGACAAGTTCCTGAGCCACGTTATCTCGGCGCTGGTTTCCGAGTACCGCT
GAACTGTGGGTGGGTGGCCGCGGGATCCCCAGGCGACCTTCCCCGTGTTTGAGTAAAGCCTCTCCCAGGAGCAGC
CTTCTTGCCGTGCTCTCTCGAGGTCAGGACGCGAGAGGAAGGCGC



CORRESPONDENCE

Contact,