Events News Research CBS CBS Publications Bioinformatics
Staff Contact About Internal CBS CBS Other

Instructions



In order to use the NetGene2 server for splice site prediction in Human, C. Elegans and Arabidopsis thaliana DNA:
  1. Select the species for which you want predictions.
  2. Select a local Fasta file by pressing the 'Browse...' bottom. Remember to make the correct file selection mask (like *.fasta). A fasta file is an ascii file with the sequence, as shown below, and should contain only one sequence.
  3. The fasta file must be submitted using the one letter abbreviations for the nucleotides: `acgtuACGTU' or 'X' for unknown.
  4. The sequence must be more than 200 (preferably more than 250) and less than 80.000 nucleotides long. Shorter sequences are accepted, but the prediction will be suboptimal. Long sequences may provoke a time out. In such cases use the mail server (NetGene2@cbs.dtu.dk). Send a mail with the word "help" to the mail server to get help.
  5. Press the "Send file" button.
  6. A WWW page will return the results as the prediction finishes. Response time depends on system load.

EXAMPLE FASTA FILE

>sequenceident
ACGACCGTGACGTGCAGTAGTGGACGATTAGCTGATGCTAGCGGCGATCGATCGTCAGT
GCAGCTGATTAGCGGCTAGCTGACTTACGCGCGGATCATTTCTAGCGTAGCTAGCTGAC
ACGTACGGCTATTATGCTACTTAGCTGACTTATTAGGCCTATATGCGATGCTATGCTAG
CGAGCAATCGCCTACAGTATGATTAGACTTTCGAGTCGATACTCGATGCTAGCTAGTGC
CGATCGATTCGATTCGATTCG



GETTING HELP

Scientific problems:        Technical problems: