Events News Research CBS CBS Publications Bioinformatics
Staff Contact About Internal CBS CBS Other

Output format


DESCRIPTION

Each input sequence will be shown with the predicted translation start site indicated, followed by a table showing the positions and the scores of all instances of "ATG" in the sequence.

In the lines below the sequence the predicted start codon is indicated by the letter "i" (initiation), other instances of "ATG" by the letter "N" (non-start). The dots (".") are place holders for all the other sequence elements.

The scores are always in [0.0, 1.0]; when greater than 0.5 they represent a probable translation start.


EXAMPLE OUTPUT

Translation start predictions for 1 vertebrate sequence

  Name: AT2A6.1
123456789012345678901234567890123456789012345678901234567890
CACGCGTCCGAAGCAAGATGGAGTCAAGTGATCGTTCAAGTCAAGCAAAAGCTTTCGACG
AGACAAAAACCGGCGTGAAAGGGCTTGTGGCTTCGGGAATCAAAGAGATTCCAGCCATGT
TCCATACACCTCCGGATACTCTAACAAGCCTGAAACAAACAGCACCA
.................i..........................................
........................................................N...
...............................................

   Pos    Score     Pred
------------------------
    18    0.821     Yes
   117    0.034     -




GETTING HELP

Scientific problems:        Technical problems: