Quick guide (Query)

Short walk through

Following, a species database and a series of parameters must be set (a set of default settings can be loaded). When the desired parameters are set, a query can be launched by pressing the "submit" button. After calculating scores for all possible probes in the input sequences, an *.owz.gz file is returned from the server and saved to disk.

The probe scores, together with the Total score (red curve) and sequence annotation can be viewed in the graphical interface. The next step is to place the probes, using the "Oligo placement" dialog. The number of probes pr. input sequence and distance between probes as well as minimum score criteria can be set. In addition, the probes can be placed with respect the sequence annotation using regular expressions.

Finally, the probes can be exported as either sense or antisense probes, with or without mismatch probes and in either tab or FASTA format.

Getting started

Setting up a query

Input formats

FASTA

Annotation containing tab file

Seq_x	ATGTCTACATATGAAGGTATGTAA	(EEEEEEEEEEEEEE)DIIIIIII	/comment

Loading input file

Setting parameters

Species database

Loading defaults

Score parameters

General

Tm

Cross-hybridization

Position

Launching a job

Interpreting the results/ placing probes

View results

Result interface

A: Graphs represent scores (y-axis) along the input sequence (x-axis). The different graphs represent different score types indicated by their color (see H). For all scores it counts that 1 is optimal and 0 is worst.

B: Color bar representing the Total (weighted) score. The Total score is also represented as a graph (thick red line). On the color bar red represent total scores higher than 0.8

C: Sequence bar. This bar represents the currently selected sequence entry (see I). The bar is color coded if sequence annotation has been supplied. Here green indicates exons and blue indicate introns.

D: Sequence inspection box / probe movement tool. The box represents the length of a probe and can be moved up and down the sequence bar (see C) using the mouse. The sequence and annotation at to current position is show below (see D). The eye (J) and hand (K) icons switched between sequence inspection and probe movement.

E: Sequence and feature annotation of the currently selected oligos, or the sequence postion being inspected (see D).

F: "Place oligos" button. Opens the dialog for automatic placement of probes.

G: A selection of options for manual manipulation of the probes.

H: Score management bar. Score weights and visual representation can be adjusted here.

I: Table of all sequence entries. One row for each entry in the original FASTA or TAB file. The columns can be sorted by clicking the header.

J: Eye icon. Put the selection box (D) in sequence inspect mode.

K: Hand icon. Put the selection box (D) in probe adjustment mode.

L: Visual representation of where the probes a located. Click on a probe to select it.

M: Export oligos. Open the dialog where probes can be exported - several file formats and advanced options are available.

N: Oligo Table. Shows all probes for the currently selected sequence entry (see I).

Score Weights

The weight of the scores can be adjusted individually (see section H above). For example this can be used to ignore certain scores completely, or to put more wieght on a parameter which is important for a special study.

Place oligos/probes

The oligo placement dialog is the main tool for probe placement in OligoWiz 2. The dialog is opened by pressing the "Place oligos..." button (see section F above) or by using the "Oligos" menu.

General oligo placement

This box in the placement dialog, governs the basic options for the distance between the probes and the Total score cut-off value.

Replacement behavior

This options governs if all existing probes should be discared prior to applying the search ruls, or if they should be kept. If old probes are kept they will be evaluated according to the search criteria before placing new probes, thus disallowing new probes in certain positions.

Filters

One of the main new features of OligoWiz 2 is the ability to take sequence feature annotation like intron/exon structure into account. The annotation is in the form of an annotation string of the same length as the DNA sequence. Each position in the annotation string describes the annotation for the corresponding position in the DNA sequence, e.g. "E" for exon and "I" for intron.

TAB files created using the FeatureExtract server contains the following type of annotation:

Sequence:   ATGTCTACATATGAAGGTATGTAATG ... TCATCATTAGATTAGAGGAACATGGAATACAACAAAACT ... ATTGGGGTATGTACGGTTAA
Annotation: (EEEEEEEEEEEEEE)DIIIIIIIII ... IIIIIIIIIIIIIIA(EEEEEEEEEEEEEEEEEEEEEEE ... EEEEEEEEEEEEEEEEEEE)

(EEEE) blocks = exons. DIIIIA blocks = introns. Some positions have been skipped ( ... ) for readbility.
For details please refer to the FeatureExtract server: output format.

Using the filters it is possible to restrict the selection of probes to regions of the input genes that has a certain type of annotation. By default the search is restricted to exonic regions - the regions annotated as (EE .. EE).

Custom filter can be defined using regular expressions - advanced string matching.

About regular expressions

(PERL style)
A regular expression is an advanced description of a text string to search for. Several closely related flavors are found. Here we focus on regular expression as the programming language PERL interprets it, since this is the most general accepted definition.

In its simplest form, a regular expression is just a word or phrase, for example "human". But sometimes an alternative word is just as good, then you may use "human|Homo sapiens". Where the sign "|" (the pipe character) means OR. Several alternatives can be listed separated by series of "|"'s.

Sometimes however, there are too many alternatives, or the alternatives may not be known, and using a wildcard becomes handy. The wildcard in regular expressions is "." (dot).

Sometimes the number of times a certain expression is repeated is uncertain. In this case the "*" (star / multiply) sign to indicate one ot more repeats. For example "TA*" will match all of the following: "T", "TA" and "TAAAA"

If an expression is expected an interval of times, putting "{n,m}" after the expression can be used to specify this: n is the minimum match counts and m the maximum. Alternatively "{n}" means exactly n times, and "{n,}" means at least n times.

If more than a single character is to be repeated in the expression it must be enclosed by "(" and ")". For example "(TA){2,4}" will match "TATA", "TATATA" and "TATATATA".

Regular expression has a series of special characters with special meanings, including "(, ), [, ], ., *, {, }, ^, !, \". However, it may be needed to search for these characters in the sequence annotation, for example in order to target the exon start and end characters "(" and "). In order to do so, the special meaning of these characters needs to be bypassed. This can be don by putting a "\" (backslash) in front of the special character. Example: "\(|\)" will search for "(" or ")".

Oligo or Regional search unit

Examples of probe placement

Example 1: Targeting exons

Region include: \(E+\)

Example 2: Targeting introns

Region include: DI+A

Example 3: Targeting long exons

Region include: \(E{200,}\)

Example 4: Exons near splice junstions

Region include: E{1,100}\)D|A\(E{1,100}
Oligo exclude:  D|A

Example 5: Cover Exon/Intron junction

Oligo include: E{4,}\)D{4,}I|I{4,}A\(E{4,}

Export oligos/ probes

When probes have been selected they may be exported as either sense or antisense probes, with or without mismatch probes and in either tab or FASTA format. By default a materials and methods section are auto generated and included. This section describes all the parameters used.

The export dialog can be opend by clicking on the "Export oligos ..." button in the main interface (see section H above) or by using the menu short cut: File -> Export oligos ...

GETTING HELP