Events News Research CBS CBS Publications Bioinformatics
Staff Contact About Internal CBS CBS Other

Usage instructions - version 2 in beta


Quick guide

Paste one or more DNA sequences (5'-3') in FASTA format into the designated box, or upload a text file with sequences in FASTA format. If desired, perform site directed mutagenesis and other advanced DNA engineering as described below (Input options). Click "submit query" to run PHUSER version 2 beta with the standard output: "circular assembly".

Table of contents

Input options Site directed mutagenesis - introduce insertions, mismatch mutations and deletions Combinatorial assembly Advanced PCR settings Salt and primer concentrations Specification of primer Tm Output options Linear Circular (default): Into a USER cassette Cassette options Basic: Predefined fusion cassettes Advanced: User designed cassettes Example of input/output data Example 1 Construction of a plasmid from 3 parts INPUT RESULTS PAGE Example 2 A point mutation and addition of a His-tag to GFP in a vector INPUT RESULTS PAGE Example 3 Construction of a small combinatorial vector library INPUT RESULTS PAGE Primer evaluation parameters Restrictions on use


Input options

As input: paste one or more DNA sequences (5'-3') in FASTA format into the designated box or upload a text file with sequences in FASTA format. PHUSER version 2 beta supports not just fusion of the fragments, but also various DNA engineering such as site directed mutagenesis (Figure 1) and combinatorial assembly (Figure 2).


Figure 1. Overview of site engineering possibilities with PHUSER version 2 beta

Site directed mutagenesis - introduce insertions, mismatch mutations and deletions

Full example: Example 2
Any desired change to a sequence i.e. mismatch mutation, deletion, or insertion can be included in the PHUSER version 2 beta query. The original and desired sequence is specified within square brackets as follows: 5' sequence [original sequence=desired sequence] sequence 3'

For example ...ACTTA[AAG=CTA]CAACT... as input means:
Original template sequence:        ...ACTTAAAGCAACT... (sequence left of "=")
Desired sequence:                         ...ACTTACTACAACT... (sequence right of "=")
Example - Site directed mutagenesis

Mismatch mutation
>Sequence1
ACGGACTAGCAGTCGCAGACTGCTAGC[GCG=AAT]ATGACGCGCGGCTACTACATCAGCT


Deletion
>Sequence1
ACGGACTAGCAGTCGCAGACTG[CTAGCGCG=]ATGACGCGCGGCTACTACATCAGCT


Insertion
>Sequence1
ACGGACTAGCAGTCGCAGACTGCTAGCGCG[=ATCGTNNNGC]ATGACGCGCGGCTACTACATCAGCT

Multiple sites can be targeted anywhere in a sequence by the introduction of more squared brackets.

Combinatorial assembly

Full example: Example 3
Combinatorial assembly is useful for purposes where the user needs to sequentially clone multiple fragments into a single cassette or site. An often encountered example is when a researcher needs to clone many different genes into the same vector backbone. PHUSER version 2 beta can design primers that allow amplification of a sequence or vector backbone only once with one set of primers, and design the primers for the genes such that every single fragment will fuse directionally to the amplified vector backbone.



Figure 2. Combinatorial assembly. Variable sequences can be inserted between "+" characters:
Example 1 - Multiple sequences into same site in vector backbone
>Vector backbone
ACGGACTAGCAGTCGCAGACTGCTACTGCCGATCGCGAGCGCTATCGACGCGATATCGCG
GGCGAGTCATATCTCGTACTCTCTACGACTGCATCGAATCTTCACGAGGACTACTACGAC
TACGATTATTACGTCCGCGCGGCATCGATCGATCGACTCGAAGCATCGTACTCGCATGCT
AGCTGACTAGCTACACGTACATCTACTACTACGCTGCTCATCGCATACTTTATCATGCGC
TACGCGCTACGTCGAGCTACGCTACG
+
>Gene1
ATGCGATGCTGGACCATTGACCAGCATAGCGTCGTATCGGGATGCTG
>Gene2
ACGTGCTAGTACGACTAGCTGCTGACCATAGTCATGCATGCAGTGCA
>Gene3
CGAGCTACGAACTATGCATCGCCGCTACTACGTATAGCTTATTCGGT
+
When choosing "circular output" (see below), the above input will result in 3 circular outputs:
Vector backbone - Gene1 - (circular)
Vector backbone - Gene2 - (circular)
Vector backbone - Gene3 - (circular)
Here the 5' end of the vector backbone will be fused to the 3' end of the genes, while the 3' end of the backbone will be fused to the 5' end of the gene.


Example 2 - Combinatorial assembly
>Sequence1
ACGGACTAGCAGTCGCAGACTGCTAGCATGACGCGCGGCTACTACATCAGCT
+
>Sequence2
ATGCGATGCTGGACCATTGACCAGCATAGCGTCGTATCGGGATGCTG
>Sequence3
ACGTGCTAGTACGACTAGCTGCTGACCATAGTCATGCATGCAGTGCA
>Sequence4
CGAGCTACGAACTATGCATCGCCGCTACTACGTATAGCTTATTCGGT
+
>Sequence5
CGATGCATGACGACGACTACAGTCGTAGCATCGATCGATCGTCGATCG
Here, primers will be generated for a total of 3 output sequences:
Sequence1 - Sequence2 - Sequence5
Sequence1 - Sequence3 - Sequence5
Sequence1 - Sequence4 - Sequence5

Advanced PCR settings

The primer pair for each fragment to be amplified is designed based on a number of quality scoring parameters, one of which is a resulting primer melting temperature (Tm) between 55-72 degrees C. By default, PHUSER version 2 beta designs primer pairs with Tm's that are optimized individually for each primer pair. However, if desired other options are available, and can be specified by choosing "advanced PCR settings".

When choosing "Advanced PCR settings" the following drop down menu will appear:

Figure 3: Screenshot of "Advanced PCR settings" supported by 2.0.

Salt and primer concentrations

Salt and primer concentrations are factors influencing Tm. PHUSER version 2 beta allows these parameters to be adjusted to resemble the specific experimental conditions required by the user. When not otherwise specified by the user, the following default settings are used: salt concentration EQ = mM, primer concentration 0.5 uM.

Specification of primer Tm

For each fragment to be amplified, the user can specify a desired Tm, and PHUSER version 2 beta will aim at designing primers as close as possible to this temperature. This is useful as it allows for multiple PCR amplifications to be performed at same Tm and hence in a single PCR program, significantly reducing the time of the cloning procedure. When choosing "Optimize equal primer Tm for all fragments", PHUSER version 2 beta will evaluate all possible Tm!s for each primer pair and define the most optimal Tm globally (for all output-fragments).
If the user desires a specific Tm for his/hers PCR program, this can be specified by typing this Tm in the option "Optimize all primer Tm to:" and PHUSER version 2 beta will chose the primer pairs with Tm's closest to this Tm. This may be useful e.g. in situations where existing Tm optimized primers are needed in the PCR reaction.

Back to top

Output options

Linear

A linear DNA sequence is produced, by fusion of the input sequences.

Example - linear assembly

Input sequence
>Sequence1
ACGGACTAGCAGTCGCAGACTGCTAGCATGACGCGCGGCTACTACATCAGCT
>Sequence2
ATGCGATGCTGGACCATTGACCAGCATAGCGTCGTATCGGGATGCTG

Cassette: PacI/Nt.BbvCI

Output sequence
Sequence1 - Sequence2 (end are joined to a circular DNA molecule)

ACGGACTAGCAGTCGCAGACTGCTAGCATGACGCGCGGCTACTACATCAGCTATGCGA
TGCTGGACCATTGACCAGCATAGCGTCGTATCGGGATGCTG
(Linear DNA)

Circular (default)

Full exapmle: Example 1
A circular DNA sequence is produced, by fusion of all the input sequences (the first and last sequence are also fused).

Example - circular assembly

Input sequence
>Sequence1
ACGGACTAGCAGTCGCAGACTGCTAGCATGACGCGCGGCTACTACATCAGCT
>Sequence2
ATGCGATGCTGGACCATTGACCAGCATAGCGTCGTATCGGGATGCTG

Cassette: PacI/Nt.BbvCI

Output sequence
- Sequence1 - Sequence2 - (end are joined to a circular DNA molecule)

...ACGGACTAGCAGTCGCAGACTGCTAGCATGACGCGCGGCTACTACATCAGCTATGCGA
TGCTGGACCATTGACCAGCATAGCGTCGTATCGGGATGCTG
... (Cicular DNA)

Into a USER cassette

A circular DNA sequence is produced, by fusion of all the input sequences to a USER cassette vector. When this option is selected, cassette options appear.

Example - USER cassette

Input sequence
>Sequence1
ACGGACTAGCAGTCGCAGACTGCTAGCATGACGCGCGGCTACTACATCAGCT
>Sequence2
ATGCGATGCTGGACCATTGACCAGCATAGCGTCGTATCGGGATGCTG

Cassette: PacI/Nt.BbvCI

Output sequence
PacI/Nt.BbvCI - Sequence1 - Sequence2 - PacI/Nt.BbvCI

PacI/Nt.BbvCIACGGACTAGCAGTCGCAGACTGCTAGCATGACGCGCGGCTACTACATCAGCTATGCGATGCTGGACCATT
GACCAGCATAGCGTCGTATCGGGATGCTG
PacI/Nt.BbvCI


Cassette options

It is possible to select from three cassette options:
  1. Basic: Predefined fusion cassettes: a predefined fusion cassette such as PacI/Nt.BbvCI can be selected.
  2. Advanced: Select restriction/nicking pair: A user-chosen combination of restriction/nicking enzymes can be selected.
  3. Advanced: User designed cassettes: The user can specify a custom cassette by providing the sequence.


Specific cassette options are specified below.

Basic: Predefined fusion cassettes

In this tab the user can select one of five predefined USER cassettes:

1:
Name:                    PacI/Nt.BbvCI
Forward strand:          GCTGAGGGTTTAATTAAGACCTCAGC
Reverse strand:          CGACTCCCAAATTAATTCTGGAGTCG

2:
Name:                    PacI/Nt.BbvCIXbaI2/Nt.BbvCI
Forward strand:          GCTGAGGGAAAGTCTAGAGGATCCTCTAGATGTCTCCTCAGC
Reverse strand:          CGACTCCCTTTCAGATCTCCTAGGAGATCTACAGAGGAGTCG

3:
Name:                    PacI/Nt.BbvCIPmeI/Nb.BbvCI
Forward strand:          CCTCAGCCGTTTAAACAGCTGAGG
Reverse strand:          GGAGTCGGCAAATTTGTCGACTCC

4:
Name:                    PacI/Nt.BbvCIAsiSI/Nb.BSMI
Forward strand:          GAATGCGTGCGATCGCGTGCATTC
Reverse strand:          CTTACGCACGCTAGCGCACGTAAG

5:
Name:                    PacI/Nt.BbvCIAsiSI/Nb.BtsI
Forward strand:          GCAGTGAGAGCGATCGCAGACACTGC
Reverse strand:          CGTCACTCTCGCTAGCGTCTGTGACG

Advanced: User designed cassettes:

Users can design entirely unique cassette, by entering the forward and reverse strand of the cassette in the following format, for example:
Forward: GCTGAGGGTTTAAT.TAAGACC.TCAGC
where the first period indicates the position of the restriction site, and second period indicates the position of the nicking site.

Reverse: CGACT.CCCAAAT.TAATTCTGGAGTCG
where first period indicates the position of the nicking site and second period indicates the position of the restriction site.

Example - User designed cassettes

Typing the following casette:
GCTGAGGGTTTAAT.TAAGACC.TCAGC
CGACT.CCCAAAT.TAATTCTGGAGTCG


Will result ing the following overhangs:
GCTGAGGGTTTAAT           TCAGC
CGACT           TAATTCTGGAGTCG
Back to top

Examples of input/output

The following 3 examples shows typical PHUSER version 2 beta input/output:

Example 1: Input data:

Construction of a plasmid from 3 parts

  1. In this example, the user wants to create a bacterial vector consisting of 3 parts:
  2. an ori of replication (FASTA header: >ori)
  3. a selection marker (FASTA header: >selection marker), and
  4. a coding sequence to be expressed (FASTA header: >CDS)

>ori
TCTCCTGAGTAGGACAAATCCGCCGCCCTAGACCTAGGGCGTTCGGCTGCGGCGAGCGGT
ATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAA
GAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGC
GTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAG
GTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGT
GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG
AAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCG
CTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGG
TAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCAC
TGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTG
GCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGT
TACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGG
TGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCC
TTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTT
GGTCATGACTAGTGCTTGGATTCTCACCAATAAAAAACGCCCGGCGGCAACCGAGCGTTC
TGAACAAATCCAGATGGAGTTCTGAGGTCATTACTGGAT

>selection marker
AACAGGAGTCCAAGCGAGCTCTCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAA
GGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGC
GGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCT
GATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTT
CCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGG
GCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGT
CCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGAT
GTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTG
CATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCC
CCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAG
CTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTGCAGTT
CATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACA
GCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATA
GCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATGCGAA
ACGATCCTCATCCTGTCTCTTGATCAGATCTTGATCCCCTGCGCCATCAGATCCTTGGCG
GCAAGAAAGCCATCCAGTTTACTTTGCAGGGCTTCCCAACCTTACCAGAGGGCGCCCCAG
CTGGCAATTCCGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGC
GTATCACGAGGCCCTTTCGTCTTCACCTCGAGTCCCTATCAGTGATAGAGATTGACATCC
CTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACCGAATTCATTAAAGA
GGAGAAAGGTACCG

>CDS
ATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGT
GATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGA
AAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTT
GTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAG
CATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTC
AAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTT
AATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAA
TTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGA
ATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGAC
CATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTAC
CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTT
CTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAA

Input parameters:

Output: circular (default)
PCR settings: default

Example 3: Output

Output report:

 
--------------------------------------
PHUSER 2.0
output generated: 30-12-2012 19:29:04
--------------------------------------

input parameters:
-----------------
number of fragments: 3
salt concentration selected: 50 nM
primer concentration selected: 0.5 uM
circular assembly (no cassette)


overview of the needed primers (5'-3'):
---------------------------------------

forward primer for ori: ATAATCUCCTGAGTAGGACAAATCC
reverse primer for ori: ACTCCTGTTAUCCAGTAATGACCTCAGAA
forward primer for selection marker: ATAACAGGAGUCCAAGCGAGCTCTCGAAC
reverse primer for selection marker: ACGCATCGGUACCTTTCTCCTCTTTAATGAATTC
forward primer for CDS: ACCGATGCGUAAAGGAGAAGAACTTTTCA
reverse primer for CDS: AGATTAUTTGTATAGTTCATCCATGC

attention: one or more of the designed primers may have undesirable properties
please see "primer details" section


overview of your final construct after cloning (circular):
----------------------------------------------------------

 ori (3' end)  selection marker  CDS  ori (5' end)  


graphic overview of DNA fragments and primers:
----------------------------------------------

fusion region and related primers for joining of ori and selection marker:

                                           5'-ATAACAGGAGU
                                                         CCAAGCGAGCTCTCGAAC-3'
5'-[...]CTGAACAAATCCAGATGGAGTTCTGAGGTCATTACTGGATAACAGGAGTCCAAGCGAGCTCTCGAACCCCAGAGTCCCGC[...]-3'
                         3'-AAGACTCCAGTAATGACC
                                              UATTGTCCTCA-5'

fusion region and related primers for joining of selection marker and CDS:

                                         5'-ACCGATGCGU
                                                      AAAGGAGAAGAACTTTTCA-3'
5'-[...]GACGCACTGACCGAATTCATTAAAGAGGAGAAAGGTACCGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAA[...]-3'
                 3'-CTTAAGTAATTTCTCCTCTTTCCA
                                            UGGCTACGCA-5'

fusion region and related primers for joining of CDS and ori:

                                         5'-ATAATCU
                                                   CCTGAGTAGGACAAATCC-3'
5'-[...]TGCTGGGATTACACATGGCATGGATGAACTATACAAATAATCTCCTGAGTAGGACAAATCCGCCGCCCTAGACCTAGGGC[...]-3'
                      3'-CGTACCTACTTGATATGTT
                                            UATTAGA-5'


primer details:
---------------
click here for detailed descriptions of primer evaluation parameters


primer details for ori

forward primer: ATAATCUCCTGAGTAGGACAAATCC
* Tm: 49.2C - in optimal range (55-72)?                   ...NO
* GC content: 50.00% - in optimal range (40-60)?          ...YES
* GC clamp present at 3' end?                             ...YES
* more than 3 G/C out of last 5 bases at 3' end?          ...NO
* risk of primer dimer formation in primer pair?          ...NO
* risk of intra-primer homology (secondary structures)?   ...NO
* presence of polyN stretches?                            ...NO

reverse primer: ACTCCTGTTAUCCAGTAATGACCTCAGAA
* Tm: 47.9C - in optimal range (55-72)?                   ...NO
* GC content: 44.44% - in optimal range (40-60)?          ...YES
* GC clamp present at 3' end?                             ...YES
* more than 3 G/C out of last 5 bases at 3' end?          ...NO
* risk of primer dimer formation in primer pair?          ...NO
* risk of intra-primer homology (secondary structures)?   ...NO
* presence of polyN stretches?                            ...NO

Tm of primers within 2C of each other?                    ...YES


primer details for selection marker

forward primer: ATAACAGGAGUCCAAGCGAGCTCTCGAAC
* Tm: 58.0C - in optimal range (55-72)?                   ...YES
* GC content: 61.11% - in optimal range (40-60)?          ...NO
* GC clamp present at 3' end?                             ...NO
* more than 3 G/C out of last 5 bases at 3' end?          ...NO
* risk of primer dimer formation in primer pair?          ...NO
* risk of intra-primer homology (secondary structures)?   ...NO
* presence of polyN stretches?                            ...NO

reverse primer: ACGCATCGGUACCTTTCTCCTCTTTAATGAATTC
* Tm: 54.1C - in optimal range (55-72)?                   ...NO
* GC content: 33.33% - in optimal range (40-60)?          ...NO
* GC clamp present at 3' end?                             ...NO
* more than 3 G/C out of last 5 bases at 3' end?          ...NO
* risk of primer dimer formation in primer pair?          ...NO
* risk of intra-primer homology (secondary structures)?   ...NO
* presence of polyN stretches?                            ...NO

Tm of primers within 2C of each other?                    ...NO


primer details for CDS

forward primer: ACCGATGCGUAAAGGAGAAGAACTTTTCA
* Tm: 48.0C - in optimal range (55-72)?                   ...NO
* GC content: 31.58% - in optimal range (40-60)?          ...NO
* GC clamp present at 3' end?                             ...YES
* more than 3 G/C out of last 5 bases at 3' end?          ...NO
* risk of primer dimer formation in primer pair?          ...NO
* risk of intra-primer homology (secondary structures)?   ...NO
* presence of polyN stretches?                            ...YES

reverse primer: AGATTAUTTGTATAGTTCATCCATGC
* Tm: 47.6C - in optimal range (55-72)?                   ...NO
* GC content: 36.84% - in optimal range (40-60)?          ...NO
* GC clamp present at 3' end?                             ...YES
* more than 3 G/C out of last 5 bases at 3' end?          ...NO
* risk of primer dimer formation in primer pair?          ...NO
* risk of intra-primer homology (secondary structures)?   ...NO
* presence of polyN stretches?                            ...YES

Tm of primers within 2C of each other?                    ...YES




details of final construct after cloning (circular, length: 2810 bases):
------------------------------------------------------------------------

 ori  selection marker  CDS  


1         TCTCCTGAGTAGGACAAATCCGCCGCCCTAGACCTAGGGCGTTCGGCTGCGGCGAGCGGT
61        ATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAA
121       GAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGC
181       GTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAG
241       GTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGT
301       GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG
361       AAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCG
421       CTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGG
481       TAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCAC
541       TGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTG
601       GCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGT
661       TACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGG
721       TGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCC
781       TTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTT
841       GGTCATGACTAGTGCTTGGATTCTCACCAATAAAAAACGCCCGGCGGCAACCGAGCGTTC
901       TGAACAAATCCAGATGGAGTTCTGAGGTCATTACTGGATAACAGGAGTCCAAGCGAGCTC
961       TCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCT
1021      GCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAA
1081      GCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCA
1141      GCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGCAAGC
1201      AGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCGCGCCTTGAGCCTGG
1261      CGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATCATCCTGATCGACAA
1321      GACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATG
1381      GGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTT
1441      TCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCA
1501      GCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCAAGGAACGCCCGTCG
1561      TGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTGCAGTTCATTCAGGGCACCGGACAGGT
1621      CGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAACACGGCGGCATCAG
1681      AGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTCCACCCAAGCGGCCG
1741      GAGAACCTGCGTGCAATCCATCTTGTTCAATCATGCGAAACGATCCTCATCCTGTCTCTT
1801      GATCAGATCTTGATCCCCTGCGCCATCAGATCCTTGGCGGCAAGAAAGCCATCCAGTTTA
1861      CTTTGCAGGGCTTCCCAACCTTACCAGAGGGCGCCCCAGCTGGCAATTCCGACGTCTAAG
1921      AAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTC
1981      TTCACCTCGAGTCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTG
2041      AGCACATCAGCAGGACGCACTGACCGAATTCATTAAAGAGGAGAAAGGTACCGATGCGTA
2101      AAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTA
2161      ATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTA
2221      CCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTA
2281      CTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACT
2341      TTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATG
2401      ACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAA
2461      TCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAAT
2521      ACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAG
2581      TTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATC
2641      AACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCA
2701      CACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGT
2761      TTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAA


primers in FASTA format (5'-3')
-------------------------------

>FW_ori_[Tm:49.6]
ATAATCUCCTGAGTAGGACAAATCC
>RV_ori_[Tm:47.9]
ACTCCTGTTAUCCAGTAATGACCTCAGAA
>FW_selection marker_[Tm:58.0]
ATAACAGGAGUCCAAGCGAGCTCTCGAAC
>RV_selection marker_[Tm:54.1]
ACGCATCGGUACCTTTCTCCTCTTTAATGAATTC
>FW_CDS_[Tm:48.0]
ACCGATGCGUAAAGGAGAAGAACTTTTCA
>RV_CDS_[Tm:47.6]
AGATTAUTTGTATAGTTCATCCATGC

Example 2: Input data:

A point mutation and addition of a His-tag to GFP in a vector

In this example, the user has a vector containing a GFP gene, and he/she wants to perform a point mutation to GFP to change proline (CCA) 195 to lysine (AAA) and additionally insert a his-tag sequence (CATCATCACCATCACCAC) in the C-terminal (5' end). To obtain a vector as the final product, he/she chooses circular output.

>vectorbackbone_with_GFP
CTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAG
TTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCT
CTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACC
ACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGA
TCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCA
CGTTAAGGGATTTTGGTCATGACTAGTGCTTGGATTCTCACCAATAAAAAACGCCCGGCG
GCAACCGAGCGTTCTGAACAAATCCAGATGGAGTTCTGAGGTCATTACTGGATAACAGGA
GTCCAAGCGAGCTCTCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATA
GAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGC
CCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCG
GTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCAT
GATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCG
CGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATC
ATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGC
TTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGC
CATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCAC
TTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCA
AGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTGCAGTTCATTCAG
GGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAA
CACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTC
CACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATGCGAAACGATCC
TCATCCTGTCTCTTGATCAGATCTTGATCCCCTGCGCCATCAGATCCTTGGCGGCAAGAA
AGCCATCCAGTTTACTTTGCAGGGCTTCCCAACCTTACCAGAGGGCGCCCCAGCTGGCAA
TTCCGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCAC
GAGGCCCTTTCGTCTTCACCTCGAGTCCCTATCAGTGATAGAGATTGACATCCCTATCAG
TGATAGAGATACTGAGCACATCAGCAGGACGCACTGACCGAATTCATTAAAGAGGAGAAA
GGTACCGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATT
AGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAAC
ATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCC
AACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATAT
GAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTAT
ATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATAC
CCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGG
ACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAA
GAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACT
AGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTA[CCA=AAA
]
GACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGA
CCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACT
ATACAAA[=CATCATCACCATCACCAC]TAA
TCTCCTGAGTAGGACAAATCCGCCGCCCT
AGACCTAGGGCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGT
TATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGG
CCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACG
AGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGAT
ACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTA
CCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCT
GTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCC
CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA
GACACGACTTATCGCCA

Input parameters:

Output construct: Circular
PCR settings: default.

Example 2: Output

Output report:

 
--------------------------------------
PHUSER 2.0
output generated: 30-12-2012 20:08:35
--------------------------------------

input parameters:
-----------------
number of fragments: 1
number of inserts: 1
salt concentration selected: 50 nM
primer concentration selected: 0.5 uM
circular assembly (no cassette)


overview of the needed primers (5'-3'):
---------------------------------------

forward primer for vectorbackbone_with_GFP: ATCGCCACUGGCAGCAGCCACTGGTAA
reverse primer for vectorbackbone_with_GFP: ATGGTTGTCTTUTAAAAGGACAGGGCCATCGCCAAT
forward primer for vectorbackbone_with_GFP: AAAGACAACCAUTACCTGTCCACACAATCT
reverse primer for vectorbackbone_with_GFP: ATGGTGAUGATGTTTGTATAGTTCATCCATGC
forward primer for vectorbackbone_with_GFP: ATCACCAUCACCACTAATCTCCTGAGTAGGACAAAT
reverse primer for vectorbackbone_with_GFP: AGTGGCGAUAAGTCGTGTCTTACCGGG

attention: one or more of the designed primers may have undesirable properties
please see "primer details" section


overview of your final construct after cloning (circular):
----------------------------------------------------------

 vectorbackbone_with_GFP (3' end)  vectorbackbone_with_GFP  insert1  vectorbackbone_with_GFP  vectorbackbone_with_GFP (5' end)  


graphic overview of DNA fragments and primers:
----------------------------------------------

fusion region and related primers for joining of vectorbackbone_with_GFP and vectorbackbone_with_GFP:

                                            5'-AAAGACAACCAU
                                                           TACCTGTCCACACAATCT-3'
5'-[...]CAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTAAAAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAA[...]-3'
                    3'-TAACCGCTACCGGGACAGGAAAAT
                                               UTTCTGTTGGTA-5'

fusion region and related primers for joining of vectorbackbone_with_GFP and vectorbackbone_with_GFP:

                                                 5'-ATCACCAU
                                                            CACCACTAATCTCCTGAGTAGGACAAAT-3'
5'-[...]AGCTGCTGGGATTACACATGGCATGGATGAACTATACAAACATCATCACCATCACCACTAATCTCCTGAGTAGGACAAATCCGCCGCCCTAGACCTAG[...]-3'
                         3'-CGTACCTACTTGATATGTTTGTAG
                                                    UAGTGGTA-5'

fusion region and related primers for joining of vectorbackbone_with_GFP and vectorbackbone_with_GFP:

                                      5'-ATCGCCACU
                                                  GGCAGCAGCCACTGGTAA-3'
5'-[...]TCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGT[...]-3'
                    3'-GGGCCATTCTGTGCTGAA
                                         UAGCGGTGA-5'


primer details:
---------------
click here for detailed descriptions of primer evaluation parameters


primer details for vectorbackbone_with_GFP

forward primer: ATCGCCACUGGCAGCAGCCACTGGTAA
* Tm: 56.9C - in optimal range (55-72)?                   ...YES
* GC content: 60.00% - in optimal range (40-60)?          ...YES
* GC clamp present at 3' end?                             ...YES
* more than 3 G/C out of last 5 bases at 3' end?          ...NO
* risk of primer dimer formation in primer pair?          ...NO
* risk of intra-primer homology (secondary structures)?   ...NO
* presence of polyN stretches?                            ...NO

reverse primer: ATGGTTGTCTTUTAAAAGGACAGGGCCATCGCCAAT
* Tm: 60.7C - in optimal range (55-72)?                   ...YES
* GC content: 50.00% - in optimal range (40-60)?          ...YES
* GC clamp present at 3' end?                             ...YES
* more than 3 G/C out of last 5 bases at 3' end?          ...YES
* risk of primer dimer formation in primer pair?          ...NO
* risk of intra-primer homology (secondary structures)?   ...NO
* presence of polyN stretches?                            ...NO

Tm of primers within 2C of each other?                    ...YES


primer details for vectorbackbone_with_GFP

forward primer: AAAGACAACCAUTACCTGTCCACACAATCT
* Tm: 49.0C - in optimal range (55-72)?                   ...NO
* GC content: 44.44% - in optimal range (40-60)?          ...YES
* GC clamp present at 3' end?                             ...YES
* more than 3 G/C out of last 5 bases at 3' end?          ...NO
* risk of primer dimer formation in primer pair?          ...NO
* risk of intra-primer homology (secondary structures)?   ...NO
* presence of polyN stretches?                            ...NO

reverse primer: ATGGTGAUGATGTTTGTATAGTTCATCCATGC
* Tm: 48.8C - in optimal range (55-72)?                   ...NO
* GC content: 35.00% - in optimal range (40-60)?          ...NO
* GC clamp present at 3' end?                             ...YES
* more than 3 G/C out of last 5 bases at 3' end?          ...NO
* risk of primer dimer formation in primer pair?          ...NO
* risk of intra-primer homology (secondary structures)?   ...NO
* presence of polyN stretches?                            ...NO

Tm of primers within 2C of each other?                    ...YES


primer details for vectorbackbone_with_GFP

forward primer: ATCACCAUCACCACTAATCTCCTGAGTAGGACAAAT
* Tm: 52.8C - in optimal range (55-72)?                   ...NO
* GC content: 36.36% - in optimal range (40-60)?          ...NO
* GC clamp present at 3' end?                             ...YES
* more than 3 G/C out of last 5 bases at 3' end?          ...NO
* risk of primer dimer formation in primer pair?          ...NO
* risk of intra-primer homology (secondary structures)?   ...NO
* presence of polyN stretches?                            ...NO

reverse primer: AGTGGCGAUAAGTCGTGTCTTACCGGG
* Tm: 54.5C - in optimal range (55-72)?                   ...NO
* GC content: 55.56% - in optimal range (40-60)?          ...YES
* GC clamp present at 3' end?                             ...YES
* more than 3 G/C out of last 5 bases at 3' end?          ...NO
* risk of primer dimer formation in primer pair?          ...NO
* risk of intra-primer homology (secondary structures)?   ...NO
* presence of polyN stretches?                            ...NO

Tm of primers within 2C of each other?                    ...YES




details of final construct after cloning (circular, length: 2828 bases):
------------------------------------------------------------------------

 vectorbackbone_with_GFP  vectorbackbone_with_GFP  insert1  vectorbackbone_with_GFP  


1         CTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAG
61        TTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCT
121       CTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACC
181       ACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGA
241       TCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCA
301       CGTTAAGGGATTTTGGTCATGACTAGTGCTTGGATTCTCACCAATAAAAAACGCCCGGCG
361       GCAACCGAGCGTTCTGAACAAATCCAGATGGAGTTCTGAGGTCATTACTGGATAACAGGA
421       GTCCAAGCGAGCTCTCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATA
481       GAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGC
541       CCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCG
601       GTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCAT
661       GATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGGGCATGCG
721       CGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATC
781       ATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGC
841       TTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGC
901       CATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCCCCGGCAC
961       TTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAGCTGCGCA
1021      AGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTGCAGTTCATTCAG
1081      GGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACAGCCGGAA
1141      CACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATAGCCTCTC
1201      CACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATGCGAAACGATCC
1261      TCATCCTGTCTCTTGATCAGATCTTGATCCCCTGCGCCATCAGATCCTTGGCGGCAAGAA
1321      AGCCATCCAGTTTACTTTGCAGGGCTTCCCAACCTTACCAGAGGGCGCCCCAGCTGGCAA
1381      TTCCGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCAC
1441      GAGGCCCTTTCGTCTTCACCTCGAGTCCCTATCAGTGATAGAGATTGACATCCCTATCAG
1501      TGATAGAGATACTGAGCACATCAGCAGGACGCACTGACCGAATTCATTAAAGAGGAGAAA
1561      GGTACCGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATT
1621      AGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAAC
1681      ATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCC
1741      AACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATAT
1801      GAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTAT
1861      ATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATAC
1921      CCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGG
1981      ACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAA
2041      GAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACT
2101      AGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTAAAAGACAA
2161      CCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACAT
2221      GGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAA
2281      ACATCATCACCATCACCACTAATCTCCTGAGTAGGACAAATCCGCCGCCCTAGACCTAGG
2341      GCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAG
2401      AATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACC
2461      GTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACA
2521      AAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGT
2581      TTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACC
2641      TGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATC
2701      TCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGC
2761      CCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACT
2821      TATCGCCA


primers in FASTA format (5'-3')
-------------------------------

>FW_vectorbackbone_with_GFP_[Tm:59.9]
ATCGCCACUGGCAGCAGCCACTGGTAA
>RV_vectorbackbone_with_GFP_[Tm:60.7]
ATGGTTGTCTTUTAAAAGGACAGGGCCATCGCCAAT
>FW_vectorbackbone_with_GFP_[Tm:49.0]
AAAGACAACCAUTACCTGTCCACACAATCT
>RV_vectorbackbone_with_GFP_[Tm:48.8]
ATGGTGAUGATGTTTGTATAGTTCATCCATGC
>FW_vectorbackbone_with_GFP_[Tm:52.8]
ATCACCAUCACCACTAATCTCCTGAGTAGGACAAAT
>RV_vectorbackbone_with_GFP_[Tm:54.5]
AGTGGCGAUAAGTCGTGTCTTACCGGG

Example 3: Input data:

Construction of a small combinatorial vector library

In this example, the user is interested in investigating the effect of exchanging the origin of replication in his vector. He therefore need to insert 3 different ori's into his backbone. To ease experimental procedures and reduce cost he wants to amplify the vector backbone with only a single pair of primers (instead of 3 pairs), and design primers for each of the ori's in such a way that they all fuse scar-less to the amplified vector backbone. This is done by typing surrounding the ori FASTA sequences with a '+' as shown below:

>front_vector_backbone_minus_ori
AACAGGAGTCCAAGCGAGCTCTCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAA
GGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGC
GGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCT
GATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTT
CCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGG
GCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGT
CCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGAT
GTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTG
CATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCC
CCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAG
CTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTGCAGTT
CATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACA
GCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATA
GCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATGCGAA
ACGATCCTCATCCTGTCTCTTGATCAGATCTTGATCCCCTGCGCCATCAGATCCTTGGCG
GCAAGAAAGCCATCCAGTTTACTTTGCAGGGCTTCCCAACCTTACCAGAGGGCGCCCCAG
CTGGCAATTCCGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGC
GTATCACGAGGCCCTTTCGTCTTCACCTCGAGTCCCTATCAGTGATAGAGATTGACATCC
CTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACCGAATTCATTAAAGA
GGAGAAAGGTACCGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTG
TTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTG
ATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTC
CATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAG
ATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAA
GAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAG
GTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACA
TTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACA
AACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCG
TTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTAC
CAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAG
ACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAAC
TATACAAATAA
+
>ori1
TCTCCTGAGTAGGACAAATCCGCCGCCCTAGACCTAGGGCGTTCGGCTGCGGCGAGCGGT
ATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAA
GAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGC
GTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAG
GTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGT
GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG
AAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCG
CTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGG
TAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCAC
TGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTG
GCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGT
TACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGG
TGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCC
TTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTT
GGTCATGACTAGTGCTTGGATTCTCACCAATAAAAAACGCCCGGCGGCAACCGAGCGTTC
TGAACAAATCCAGATGGAGTTCTGAGGTCATTACTGGAT
>ori2
GCGCTAGCGGAGTGTATACTGGCTTACTATGTTGGCACTGATGAGGGTGTCAGTGAAGTG
CTTCATGTGGCAGGAGAAAAAAGGCTGCACCGGTGCGTCAGCAGAATATGTGATACAGGA
TATATTCCGCTTCCTCGCTCACTGACTCGCTACGCTCGGTCGTTCGACTGCGGCGAGCGG
AAATGGCTTACGAACGGGGCGGAGATTTCCTGGAAGATGCCAGGAAGATACTTAACAGGG
AAGTGAGAGGGCCGCGGCAAAGCCGTTTTTCCATAGGCTCCGCCCCCCTGACAAGCATCA
CGAAATCTGACGCTCAAATCAGTGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGC
GTTTCCCCCTGGCGGCTCCCTCGTGCGCTCTCCTGTTCCTGCCTTTCGGTTTACCGGTGT
CATTCCGCTGTTATGGCCGCGTTTGTCTCATTCCACGCCTGACACTCAGTTCCGGGTAGG
CAGTTCGCTCCAAGCTGGACTGTATGCACGAACCCCCCGTTCAGTCCGACCGCTGCGCCT
TATCCGGTAACTATCGTCTTGAGTCCAACCCGGAAAGACATGCAAAAGCACCACTGGCAG
CAGCCACTGGTAATTGATTTAGAGGAGTTAGTCTTGAAGTCATGCGCCGGTTAAGGCTAA
ACTGAAAGGACAAGTTTTGGTGACTGCGCTCCTCCAAGCCAGTTACCTCGGTTCAAAGAG
TTGGTAGCTCAGAGAACCTTCGAAAAACCGCCCTGCAAGGCGGTTTTTTCGTTTTCAGAG
CAAGAGATTACGCGCAGACCAAAACGATCTCAAGAAGATCATCTTATTAATCAGATAAAA
TATTTCTAGATTTCAGTGCAATTTATCTCTTCAAATGTAGCACCTGAAGTCAGCCCCATA
CGATATAAGTTGT
>ori3
AGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAA
AAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTC
CGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTCCTTCTAGTGTAGCCGT
AGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCC
TGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGAC
GATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCA
GCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCG
CCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAG
GAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGT
TTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTAT
GGAAAAACGCCAGCAACGCG
+
>back_vector_backbone_minus_ori
GCTTCCCAACCTTACCAGAGGGCGCCCCAG
CTGGCAATTCCGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGC
GTATCACGAGGCCCTTTCGTCTTCACCTCGAGTCCCTATCAGTGATAGAGATTGACATCC
CTATCAGTGATAGAGATACTGAGCACATCAGCAGGACGCACTGACCGAATTCATTAAAGA
GGAGAAAGGTACCGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTG
TTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTG
ATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTC
CATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAG
ATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAA
GAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAG
GTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACA
TTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACA
AACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCG
TTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTAC
CAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAG
ACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAAC
TATACAAATAAAACAGGAGTCCAAGCGAGCTCTCGAACCCCAGAGTCCCGCTCAGAAGAA
GGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGC
GGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCT
GATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTT
CCACCATGATATTCGGCAAGCAGGCATCGCCATGGGTCACGACGAGATCCTCGCCGTCGG
GCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGT
CCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGAT
GTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCGGATCAAGCGTATGCAGCCGCCGCATTG
CATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGGTGAGATGACAGGAGATCCTGCC
CCGGCACTTCGCCCAATAGCAGCCAGTCCCTTCCCGCTTCAGTGACAACGTCGAGCACAG
CTGCGCAAGGAACGCCCGTCGTGGCCAGCCACGATAGCCGCGCTGCCTCGTCCTGCAGTT
CATTCAGGGCACCGGACAGGTCGGTCTTGACAAAAAGAACCGGGCGCCCCTGCGCTGACA
GCCGGAACACGGCGGCATCAGAGCAGCCGATTGTCTGTTGTGCCCAGTCATAGCCGAATA
GCCTCTCCACCCAAGCGGCCGGAGAACCTGCGTGCAATCCATCTTGTTCAATCATGCGAA
ACGATCCTCATCCTGTCTCTTGATCAGATCTTGATCCCCTGCGCCATCAGATCCTTGGCG
GCAAGAAAGCCATCCAGTTTACTTTGCAGGCTCGTCAAGAA

Input parameters:

Output: linear
PCR settings: default

Output report:

 
--------------------------------------
PHUSER 2.0
output generated: 30-12-2012 21:12:45
--------------------------------------

input parameters:
-----------------
number of batches: 3
circular assembly (no cassette)


primers in FASTA format (5'-3')
-------------------------------

batch 1
>FW_front_vector_backbone_minus_ori_[Tm:51.3]
AAACAGGAGUCCAAGCGAGCTCTCGAAC
>RV_front_vector_backbone_minus_ori_[Tm:50.1]
AGATTAUTTGTATAGTTCATCCATGCCATG
>FW_ori1_[Tm:45.4]
ATAATCUCCTGAGTAGGACAAATCC
>RV_ori1_[Tm:45.5]
AGCATCCAGUAATGACCTCAGAACTCCA
>FW_back_vector_backbone_minus_ori_[Tm:50.8]
ACTGGATGCUTCCCAACCTTACCAGAGGG
>RV_back_vector_backbone_minus_ori_[Tm:50.9]
ACTCCTGTTUTCTTGACGAGCCTGCAAA

batch 2
>FW_front_vector_backbone_minus_ori_[Tm:51.3]
AAACAGGAGUCCAAGCGAGCTCTCGAAC
>RV_front_vector_backbone_minus_ori_[Tm:50.1]
AGCGCTTAUTTGTATAGTTCATCCATGCCATG
>FW_ori2_[Tm:50.4]
ATAAGCGCUAGCGGAGTGTATACTGGC
>RV_ori2_[Tm:50.0]
AGCACAACUTATATCGTATGGGGCTGACT
>FW_back_vector_backbone_minus_ori_[Tm:50.8]
AGTTGTGCUTCCCAACCTTACCAGAGGG
>RV_back_vector_backbone_minus_ori_[Tm:50.9]
ACTCCTGTTUTCTTGACGAGCCTGCAAA

batch 3
>FW_front_vector_backbone_minus_ori_[Tm:51.3]
AAACAGGAGUCCAAGCGAGCTCTCGAAC
>RV_front_vector_backbone_minus_ori_[Tm:50.1]
ATCTTTAUTTGTATAGTTCATCCATGCCATG
>FW_ori3_[Tm:47.0]
ATAAAGAUCAAAGGATCTTCTTGAGATC
>RV_ori3_[Tm:48.3]
AAGCCGCGUTGCTGGCGTTTTTCCATA
>FW_back_vector_backbone_minus_ori_[Tm:49.3]
ACGCGGCTUCCCAACCTTACCAGAGGG
>RV_back_vector_backbone_minus_ori_[Tm:50.9]
ACTCCTGTTUTCTTGACGAGCCTGCAAA

Back to top

Primer evaluation parameters

Primer evaluation parameters The assessment of each parameter is highlighted in either green (signifying a positive assessment) or red (signifying a negative assessment) - Please see example output report below. Note that the primer parameters used for optimal primer design is supplied only to evaluate the efficiency of a specific amplification and not the competence of the amplification. Therefore, the lack of positive assessment in any parameter (or all parameters) does not preclude a useful PCR outcome.

Tm of primers: PHUSER ranks the Tm of primers on whether it is in the range 55-72 C. Primers for which the Tm falls in this region are marked with a green "Yes", primers for which the Tm falls outside this region are marked with a red "No".

GC content: The GC content (number of dGTP plus dCTP as a percentage of the total number of nucleic acid residues) should ideally be between 40-60 %, to keep annealing temperature within a favorable range. Primers for which the GC content falls in this region are marked with a green "Yes", primers for which the GC content falls outside this region are marked with a red "No".

Presence of 3' end GC clamp: Due to the stronger annealing of guanine and cytosine with complementary bases, specific binding is promoted by the presence of at least one of either of these bases in the last five bases of the 3' end (GC-clamp). Primers which have 1 or 2 G or C in this region are marked with a green "Yes", primers which have 0 or more than 2 G or C in this region are marked with a red "No".

More than 3 G/C out of last 5 bases at 3' end?: If more than 3 out of the last 5 bases at the 3' end are guanine or cytosine, the binding to the DNA fragment may be too strong. Primers which have less than 3 G or C in this region are marked with a green "No", primers which have 3 or more C in this region are marked with a red "Yes".

Risk of primer dimer formation in primer pair: Stretches of more than five complimentary bases between different primers used in the same PCR can lead to primer dimer formation, which can interfere with the desired hybridization and result in reduced PCR efficiency. With PHUSER the risk of inter-primer homology is assessed based on the relationship between the Tm of the primer and the complimentary bases potentially leading to undesirable dimerization. If the Tm of the potential inter-primer dimerization is at least 10C smaller than that of the annealing temperature used in the PCR cycle, the risk of homology is considered theoretical and the parameter is marked with a green "No", since most of the DNA which could undesirably hybridize is denatured at this higher temperature. If the opposite is the case, the parameter is marked with a red "Yes".

Risk of intra-primer homology (secondary structures): Similarly, stretches of more than three complimentary bases within a primer can lead to formation of intra-primer secondary structures, resulting in reduced PCR efficiency. With PHUSER the risk of intra-primer homology is assessed based on the relationship between the Tm of the primer and the complimentary bases potentially leading to undesirable intra-primer secondary structures. If the Tm of the intra-primer secondary structure formation is at least 10° C smaller than that of the annealing temperature used in the PCR cycle, the risk of homology is considered theoretical and the parameter is marked with a green "No", since most of the DNA which could undesirably hybridize is denatured at this higher temperature. If the opposite is the case, the parameter is marked with a red "Yes".

Presence of PolyN stretches: Sequences consisting of 4 or more consecutive identical nucleotides within the primer are known as polyN stretches; polyG or polyC stretches promote non-specific annealing, whereas polyA or polyT can cause the "opening" of stretches of the primer template complex, referred to as "breathing". If the primers contain stretches of more than 4 consecutive identical nucleotides within a primer, the parameter is highlighted with a red "Yes", if not; the parameter is highlighted with a red "No".

Tm of primers within 2C of each other: For a given primer pair, the primers' Tm should be within 2C of each other, in order to achieve efficient PCR amplification. If this is the case, the parameter is marked with a green "Yes", if not; the parameter is marked with a red "No".

Back to top

Restrictions on use

Please note
  • A maximum of 50 jobs can be submitted by each user every 24 hours.
  • Salt concentration must be between 10 and 150 mM
  • Tm must be between 40 and 72 degrees
  • Primer concentration must be between 0.05 and 5 uM
  • When site-directed mutagenesis is performed within 40 bp from end of a fragment, the 40 bp will be included as an insertion.



GETTING HELP

Scientific and Technical problems: