Events News Research CBS CBS Publications Bioinformatics
Staff Contact About Internal CBS CBS Other

Please use our new tool: AMUSER

-integrating all functionality of PHUSER and a lot more.
PHUSER will no longer be updated.

PHUSER 1.2 offers quick and easy design of PCR optimized primers for USER fusion of custom DNA fragments.

Instructions Output format Software download Article abstract

Paste in one or more DNA sequences in FASTA format

or upload DNA sequences in FASTA format


View example DNA files

Instructions: Paste in or upload one or more DNA sequences in FASTA format, select a Fusion cassette below, and hit submit.
(Notice that a single DNA sequence can be used as well, if it will be fragmented by using the option for automatic adjustment of length).

">linker" problem: We apologize for the inconvenience, but the linker insertion feature is temporarily out of function.
This only regards primer design when typing the input FASTA header ">Linker". We are currently working on solving the problem.


Automatic adjustment of maximum PCR product length:

This option can be used to automatically divide the input sequence into fragments of shorter length, to ensure PCR products below a certain threshold length.

Brief instructions: Select a complete predefined fusion cassette on the list below - this will provide all the information needed. If you don't need to clone your fused construct into a vector, you can select LINEAR, and no cassette will be used

Predifined fusion cassettes:

Here you can select a predefined fusion cassette (see details below)
[details]

1:
Name:                PacI/Nt.BbvCI
Forward strand:      GCTGAGGGTTTAATTAAGACCTCAGC
Reverse strand:      CGACTCCCAAATTAATTCTGGAGTCG

2:
Name:                XbaI2/Nt.BbvCI
Forward strand:      GCTGAGGGAAAGTCTAGAGGATCCTCTAGATGTCTCCTCAGC
Reverse strand:      CGACTCCCTTTCAGATCTCCTAGGAGATCTACAGAGGAGTCG

3:
Name:                PmeI/Nb.BbvCI
Forward strand:      CCTCAGCCGTTTAAACAGCTGAGG
Reverse strand:      GGAGTCGGCAAATTTGTCGACTCC
4:
Name:                AsiSI/Nb.BSMI
Forward strand:      GAATGCGTGCGATCGCGTGCATTC
Reverse strand:      CTTACGCACGCTAGCGCACGTAAG

5:
Name:                AsiSI/Nb.BtsI
Forward strand:      GCAGTGAGAGCGATCGCAGACACTGC
Reverse strand:      CGTCACTCTCGCTAGCGTCTGTGACG

Brief instructions: Instead of using a predifined fusion cassette, you can choose your own restriction-/nicking-site pair below, and enter custom directional bases. Notice that you MUST select both AND define a set of directional bases. Selections in this section will have priority over any predifined cassette previously selected.

Restriction:

[details]

AsiSI :  GCGAT.CGC 
PacI  :  TTAAT.TAA
PmeI  :  GTTT.AAAC
SwaI  :  ATTT.AAAT
XbaI  :  T.CTAGA
MssI  :  GTTT.AAAC
RgaI  :  GCGAT.CGC
SgfI  :  GCGAT.CGC
SmiI  :  ATTT.AAAT
SrfI  :  GCCC.GGGC
 

Nicking:

[details]

Nb.BbvCI  :  CCTCA.GC
Nb.BsmI   :  GAATG.CT
Nb.BsrDI  :  GCAATG.GG
Nb.BtsI   :  GCAGTG.CT
Nt.AlwI   :  C.TCTCGATCC
Nt.BbvCI  :  GCTGA.GG
Nt.BsmAI  :  C.AGAGAC
Nt.BspQI  :  .AGAAGAGC
Nt.BstNBI :  T.TAGTCTGAT
 

Directional bases

Forward:

Reverse:

[details]

Brief instructions: In this section it is possible to define completely custom fusion cassettes. Please refer to the Instruction page for examples. Selections made in this section have priority over ANY other setttings - use with care.

Custom designed fusion cassettes

Forward strand:

Example: GCTGAGGGTTTAAT.TAAGACC.TCAGC
first period indicates the position of the restriction site, and second period indicates the position of the nicking site

Reverse strand:

Example: CGACT.CCCAAAT.TAATTCTGGAGTCG
first period indicates the position of the nicking site, and second period indicates the position of the restriction site

[details]


Restrictions:

Please read the CBS access policies for information about limitations on the daily number of submissions. The command-line version of PHUSER is free software, and be downloaded here: Software Download.

Confidentiality:
The sequences are kept confidential and will be deleted after processing.


CITATIONS

For publication of results, please cite:

Lars Rønn Olsen, Niels Bjørn Hansen, Mads Tvillinggaard Bonde, Hans Jasper Genee, Dorte Koefoed Holm, Simon Carlsen, Bjarne Gram Hansen, Kiran Raosaheb Patil, Uffe Mortensen, Rasmus Wernersson
PHUSER (Primer Help for USER): A novel tool for USER fusion primer design
Nucl. Acids Res. 2011, accepted for publication

View the abstract.

Keywords: Polymerase Chain Reaction, PCR, Cloning, Primers, Uracil Specific Exision Reagent (USER) fusion, USER fusion, gene fusion, primer design.


PORTABLE VERSION

The commandline version of PHUSER is open source software (GPL license) and can be downloaded here.

If you require PHUSER a commerical license, please contact software@cbs.dtu.dk.


GETTING HELP

Correspondence: