Events News Research CBS CBS Publications Bioinformatics
Staff Contact About Internal CBS CBS Other

PHUSER - Download


Command line PHUSER

PHUSER is written in PERL with a Python wrapper providing a user-friendly interface. If should work on any UNIX like system (including Linux and MacOS X) with minimal setup.

Setup: You need to 1) modify the first line on the Python script to point to your local Python installation (e.g. /usb/ 2) change the BINDIR variable to point to the directory where you have place the two PHUSER scripts.

The program is invoked from the shell (command line), and has a build in help page (phuser.py -h).

Download PHUSER v.1.1: [February 2011] phuser-1.1.tgz



PHUSER help page

 
PHUSER v 1.1 (command line program behind the PHUSER webserver) 

NAME
	PHUSER - Primer helper for USER
		 
SYNOPSIS
	phuser [options...] file(s)
	
DESCRIPTION

	PHUSER is a tool for designing primers for USER fusion

	This tool ensures non-overlapping fusion tails, enabling
	the user to fuse more than two DNA fragments together in
	one reaction, as long as unique fusion tails exist.
	
	PHUSER also ensures that the melting temperature (Tm) of the
	primers are pairwise within 2 degrees celsius of each other,
	optimizing the primers for PCR amplification.

	The files containing the input DNA sequences are specified 
	seperately as commandline input or STDIN. The program can 
	handle almost any format of DNA (e.g. fasta, spaces, new 
	lines, etc.).

	A cassette is chosen by the -c option (see below)
	
	The needed primers will be printed to a user-defined output
	file with the following three segments of information:

	Overview of primers:
	--------------------
	Short print out of the needed primers.

	Grafic overview of DNA fragments and primers:
	---------------------------------------------
	The first graphic illustrates the forward primer for 
	DNA fragment 1, i.e. binding region to biobrick 1, 
	and fusion tail to the selected USER cassette. The 
	following graphics (the number depends on how many 
	DNA sequences were submitted) illustrates the region 
	at which DNA fragment 1 is fused to DNA fragment 2 
	and so forth. The last 40 bases of DNA fragment 1 and 
	the first 40 bases of DNA fragment 2 are displayed, 
	along with the positioning of the fusion tails and 
	binding regions for both reverse and forward primers. 
	The last graphic of the overview illustrates the last 
	DNA fragment and its binding region to the selected 
	cassette, diplayed in a similar fashion as described 
	for the first block.
		
	Primer details:
	---------------
	The primers are printed again with corresponding data
	about DNA melting temperature (Tm) and GC ratio. Also
	provided is the status of Tm or GC ratio in terms of
	optimum The value of the two parameters is succeeded 
	by either '...YES' or '...NO', depending on the status.

OPTIONS	
	-c, --cassette
		Select which cassete to use, by specifying one of the 
		predefined sets listed below, or LINEAR (0) for avoiding
		the use of the restriction site primers at the borders
		of the fused construct.
		
		DEFAULT: "1" (PacI/Nt.BbvCI)
		
		1 :
			Name:                PacI/Nt.BbvCI
			Forward strand:      GCTGAGGGTTTAATTAAGACCTCAGC
			Reverse strand:      CGACTCCCAAATTAATTCTGGAGTCG
			Fusion tail forward: GGGTTTAAU
			Fusion tail reverse: GGTCTTAAU
			
		2 :
			Name:                XbaI2/Nt.BbvCI
			Forward strand:      GCTGAGGGAAAGTCTAGAGGATCCTCTAGATGTCTCCTCAGC
			Reverse strand:      CGACTCCCTTTCAGATCTCCTAGGAGATCTACAGAGGAGTCG
			Fusion tail forward: GGGAAAGU
			Fusion tail reverse: GGAGACAU
			
		3 :
			Name:                PmeI/Nb.BbvCI
			Forward strand:      CCTCAGCCGTTTAAACAGCTGAGG
			Reverse strand:      GGAGTCGGCAAATTTGTCGACTCC
			Fusion tail forward: GCCGTTU
			Fusion tail reverse: GCTGTTU
			
		4 :
			Name:                AsiSI/Nb.BsmI
			Forward strand:      GAATGCGTGCGATCGCGTGCATTC
			Reverse strand:      CTTACGCACGCTAGCGCACGTAAG
			Fusion tail forward: CGTGCGAU
			Fusion tail reverse: CACGCGAU
			
		5 :
			Name:                AsiSI/Nb.BtsI
			Forward strand:      GCAGTGAGAGCGATCGCAGACACTGC
			Reverse strand:      CGTCACTCTCGCTAGCGTCTGTGACG
			Fusion tail forward: AGAGCGAU
			Fusion tail reverse: TCTGCGAU
			
		

	-n, --nick
		Specify nicking site - must the done together with 
		the -r option.

		Nb.BbvCI  :  CCTCA.GC
		Nb.BsmI   :  GAATG.CT
		Nb.BsrDI  :  GCAATG.GG
		Nb.BtsI   :  GCAGTG.CT
		Nt.AlwI   :  C.TCTCGATCC
		Nt.BbvCI  :  GCTGA.GG
		Nt.BsmAI  :  C.AGAGAC
		Nt.BspQI  :  .AGAAGAGC
		Nt.BstNBI :  T.TAGTCTGAT
		
	-r, --restrict
		Specify the respriction site - must be done together
		with the -n option.
		
		AsiSI :  GCGAT.CGC 
		PacI  :  TTAAT.TAA
		PmeI  :  GTTT.AAAC
		SwaI  :  ATTT.AAAT
		XbaI  :  T.CTAGA
		MssI  :  GTTT.AAAC
		RgaI  :  GCGAT.CGC
		SgfI  :  GCGAT.CGC
		SmiI  :  ATTT.AAAT
		SrfI  :  GCCC.GGGC

	--cassette_fwd
		User defined cassette: FORWARD strand - must be used
		together with the --cassette_rev option.
		
		Example: GCTGAGGGTTTAAT.TAAGACC.TCAGC

	--cassette_rev
		User defined cassette: REVERSE strand - must be used
		togehter with the --cassette_fwd option.
		
		Example: CGACT.CCCAAAT.TAATTCTGGAGTCG

	--fasta
		Also export primer sequences in FASTA format to the 
		specified file.
		
	--report
		Also export the analysis report to the specified file.
		
	-l, --maxlength
		Fragment input sequences longer that the specied treshhold
		into sub-sequences before running the main algorithm.
		
		The aim is to automatically avoid overly long PCR products.
		
		DEFAULT: 0 (disabled).
		
	-h, --help
		Print this help page and exit
		
		
KNOWN ISSUES
	The program operates within the physical constraints of USER 
	fusion primers. Theoretically, the program can design primers 
	for fusion of as many DNA fragments in one reaction, as long 
	as unique fusion tails exists. However, experimental results 
	suggests that no more than 6-7 fragments can be fused in one 
	reaction.

REFERENCE
	(Submitted to Nucleic Acids Research, Jan 2011).

WEB
	http://www.cbs.dtu.dk/services/PHUSER
	
	The webpage contains detailed instructions and examples.
	The most recent version of this program is downloadable
	from this web address.

AUTHORS
	Lars Ronn Olsen, lronn@bio.dtu.dk (PERL part - main prog).
	Rasmus Wernerson, raz@cbs.dtu.dk (Python & Web).
	
	Dec 2009 - Dec 2010

   
    



GETTING HELP

Contact: