Events News Research CBS CBS Publications Bioinformatics
Staff Contact About Internal CBS CBS Other

Usage instructions



Quick guide

Paste one or more DNA sequences in FASTA format into the designated box, or upload a text file with sequences in FASTA format. Click "submit query" to run PHUSER with the standard cassette (PacI/Nt.BbvCI).

NOTICE: All input sequences must be at least 40bp of length, and cannot contain ambigous characters (only ATGC is accepted).


Automatic adjustment of maximum PCR product length

If a certain length of DNA fragments are desired for PCR, the user can specify the maximum length of the PCR products here. The selections range from 100bp to 10,000bp. If for example 100bp is selected, each submitted DNA sequences will be split into fragments of maximum 100bp in length. A primer set is designed for each fragment, so the fragments can be assembled using USER fusion. If "(not used)" is selected, primers will be designed for the fragments as submitted.

Linker insertion

PHUSER enables the insertion of linkers between the DNA fragments. This is done simply by including a FASTA entry between the fragments with the exact header: ">linker".

Cassette options

Advanced users may select from three cassette options. The details for each options is show when the respective tab is clicked. The default selection is the standard cassette, PacI/Nt.BbvCI, in the tab titled "1) Basic: Predefined fusion cassettes". If a selection is made in the tab titled "2) Advanced: select restriction/nicking pair", any selection in tab 1 will be overruled. Similarly, if a selection is made in the tab titled "3) Advanced: User designed cassettes", all other cassette options are overruled. Cassette options can be reset by clicking "Clear fields" located below the sequence submission options.

Predefined cassettes

In this tab the user can select one of five predefined USER cassettes:

1:
Name:                    PacI/Nt.BbvCI
Forward strand:          GCTGAGGGTTTAATTAAGACCTCAGC
Reverse strand:          CGACTCCCAAATTAATTCTGGAGTCG

2:
Name:                    PacI/Nt.BbvCIXbaI2/Nt.BbvCI
Forward strand:          GCTGAGGGAAAGTCTAGAGGATCCTCTAGATGTCTCCTCAGC
Reverse strand:          CGACTCCCTTTCAGATCTCCTAGGAGATCTACAGAGGAGTCG

3:
Name:                    PacI/Nt.BbvCIPmeI/Nb.BbvCI
Forward strand:          CCTCAGCCGTTTAAACAGCTGAGG
Reverse strand:          GGAGTCGGCAAATTTGTCGACTCC

4:
Name:                    PacI/Nt.BbvCIAsiSI/Nb.BSMI
Forward strand:          GAATGCGTGCGATCGCGTGCATTC
Reverse strand:          CTTACGCACGCTAGCGCACGTAAG

5:
Name:                    PacI/Nt.BbvCIAsiSI/Nb.BtsI
Forward strand:          GCAGTGAGAGCGATCGCAGACACTGC
Reverse strand:          CGTCACTCTCGCTAGCGTCTGTGACG
If no cassette is chosen (option "[0 LINEAR]"), primers will be designed for the DNA fragments only, thus supporting linear cloning.

Restriction/nicking pairs

Alternatively, the user can choose create a custom cassette by selecting a restriction site, a nicking site, and enter the directional bases linking the two together.

For example, the following parameters will yield the cassette below:

Restriction site (selected from pull-down menu):                      "AsiSI"
Nicking site (selected from pull-down menu):                            "Nb.BbvCI"
Forward directional bases (entered in designated field):        "AT"
Reverse directional bases (entered in designated field):        "GC"

Resulting cassette:

Forward: CCTCAGCATGCGAT.CGCGCGC.TGAGG
Reverse: GGAGT.CGGCCGC.TAGCGATCGACTCC

Custom cassettes

Lastly, users can design entirely unique cassette, by entering the forward and reverse strand of the cassette in the following format:

Forward: GCTGAGGGTTTAAT.TAAGACC.TCAGC
where the first period indicates the position of the restriction site, and second period indicates the position of the nicking site.

Reverse: CGACT.CCCAAAT.TAATTCTGGAGTCG
where first period indicates the position of the nicking site, and second period indicates the position of the restriction site.

The user is here restricted to using only one restriction site, and one nicking site.

Examples

The following example shows a typical PHUSER input/output:

Example: Input data:

>gene1
TCCACCCTATTGAGGCATTGACTGATGCGGGAAGAGATCTGAAATGAACTGGTCTATGCGACAGAAACTGTGCAGCTACC
TAATCTCCTTAGTGTAGGTTCTGACCGATTCGTGCTTCGTTGAGAACTCACAATTTAACAACAGAGGACATAAGCCCTAC
GCCCATGATCTACTGACGTCCCTGAGGCTGCAATTCATGTAATGGGACAGTATCCGCGGCAAGTCCTAGTGCAATGGCGG
TATTCTACCCTCGTACTGTAGTAGAGGCGACGCGGGTGCGGTCATCACTAATAAGGATATTGGGAAGACTCACAGGCCTC
CGCCTTTAGGCGGTGCTTACTCTTACATAAAGGGGCTGTTAGTATTACCCCGCGAGGATTCGAAAAGGTGAGCCAACCCG
GCCGATCCGGAGAGACGGGCCTCAAAGCCGCGTGACGACGGCTGTGGGCCCGTAACAAAATCCCCGCAATAAGCTCCCGT
GAGCGTCGGTTGAACAGCCCTGGTCGGCCCCATCAGTAGCCCGAATATGTCGCTTTACGGGTCCTGGGCCGGGGTGCGAT
ACCTTGCAGAAATCGAGGCCGTTCGTTAATTCCTGTTGCATTCGTACCGCCTATATTTGTCTCTTTGCCGGCTTATATGG
ACAAGCATAGCATAGCCATTTATCGGAGCGCCTCCGTACACGGTATGATCGGACGCCTCGTGAGATCAATACGTATACCA
GGTGTCCTGTGAGCAGCGAAAGCCTATACGCGAGATACACTGCCAAAAATCCGCGTGATTACGAGTCGTGGCAAATTTGG
TCTGGCTGTGGTCTAGACATTCCAGGCGGTGCGTCTGCTCTCGGGTGCCTCTAGTGGCTGGCTAGATAGACTAGCCGCTG
GTAAACACACCATGACCCCGGCTCTCCATTGATGCCACGGCGATTGTTGGAGAGCCAGCAGCGACTGCAAACATCAGATC
AGAGTAATACTAGCATGCGATAAGTCCCTAACTGACTATG 
>gene2
GCCTTCTGTAGAGTCAACTTCACCACATATGCTGTCTCTGGCACGTGGATGGTTTAGAGGAATCAGATTCAAGTCTGGTT
AACCATCAAACAGGTCTTGAGTCTAAAATTGTCGTCTCCTGCGTACGAGATGGAAATACTAGGTAACTACAGGGACTCCG
ACGTTATGTACGTTGCTCCGTCAGAGGCGCCATTCAGGATCACGTTACCGCGAAAAAAAGGGACCAGGAGCTCTTCTCCC
CTGCGGTCACGTCTATAGAAATTACACCATTAACCCTCCTGAGAACCGGGAGGCGGGAATCCGTCACGTATGAGAAGGTA
TTTGCCCGATAATCAATACCCCAGGCTTCTAACTTTTTCCACTCGCTTGAGCCGGCTAGGCCTTTCTGCCCGAAGTTTCG
ATGGACTGGTGCCAACGCGCAGGCATAGTTTTAGGAGAATTATTCGGGGGCAGTGACAACCAACATCTCGGGTCCTGCCC
AACCGGTCTACACGCTAATATAGCGAATCACCGAGAACCCGGCGCCACGCAATGGAACGTCCTTAACTCCGGCAGGCAAT
TAAAGGGAACGTATGTATAACGCAAAAAAACAGAAAAATAGGCGAATGAATCTTTTCTCTGTGTATCGAAGAATGGCCTC
GCGGAGGCATGCGTCATGCTAGCGTGCGGGGTACTCTTGCTATCCATATGGTCCACAGGACACTCGTTGTTTTCGGATTT
ACCCTTTATGCGCCGGTTTTCAGCCACGCTTATGCCCAGCATCGTTACAACCAGACCGATACTAGATGTATAAAGTCCGC
CATGCAGACGAGACCAGTCGGAGATTACCGAGCATTCTATCAGGTCGGCGACCACTAGTGAGCTACTGGAGCCGAGGGGT
AACCACGATGCCGCTAAGAACCTCTCGGTCGACGCAAGCGATTACACTCCTGTCACATCATAATCGTTTGCTATTCAGGG
GTTGACCAACACCGGAAAACTTTTCACTTGAAGTATTGTA 
>gene3
TACGACAGGGTGCGTGTACCTACCAAACCTGTTTAAACTAAGTTCAGACTAGTTGGAAGTGTGTCTAGATCTTAGTTTTC
GTCACTAGAGGGCCCACGCTTTATTTTTATGATCCATTGATCTCCCAGACGCTGCAAGATTTGCAACCAGGCAGACTTGG
CGGTAGGTCCTAGTGCAGCGGGACTTTTTTTCTATAGTCCTTGAGAGGAGGAGTCGTCAGTCCAGATACCTTTGATGTCC
TGATTGGAAGGACCGTTGGCCCCCCACCCTTAGGCAGTGTACTCAGTTCCATAAACGAGCTATTAGATATGAGGTCCGTA
GATTGAAAAGGGTGACGGAATTCGCCCGAACGGGAAAGACGGACAACTAGGTATCCTGAGCACGGTTGCGCGTCCGTATC
AAGCTCCTCTTTATAGGCCCCGGTTTCTGTTGGTCGTAGAGCGCAGAACGGGTTGGGGGGATGTACGACAATATCGCTTA
GTCACCTTTGGGCCACGGTCCGCTACCTTACAGGAATTGAGACCGTCCTTTAATTTCCCTTGCATATATGTTGCGTTTCT
TCGACCTTTTAACCGCTCCCTTAGGAGAAAGACAGATAGCTTCTTACCCGTACTCCACCGTTGGCAGCACGATCGCATGT
CCCACGTGAACCATTGGTAAACCCTGTGGCCTGTGAGCGACAAAAGCTTTAATGGGAAATTCGCGCCCATAACTTGGTCC
GAATACGGGTCCTAGCAACGTTCGTCTGAGTTTGATCTATATAATACGGGCGGTATGTCTGCTTTGATCAACCTCCAATA
GCTCGTATGATAGTGCACCCGCTGGTGATCACTCAATGATCTGGGCTCCCCGTTGCAACTACGGGGATTTTTCGAGACCG
ACCTGCGTTCGGCATTGTGGGCACAGTGAAGTATTAGCAAACGTTAAGTCCCGAACTAGATGTGACCTAACGGTAAGAGA
ATTTCATAATACGTCCTGCCGCACGCGCAAGGTACATTTG

Example: Output

Input parameters:

*) Automatic adjustment of maximum PCR product length: "(not used)"
*) Predifined fusion cassette: "PacI/Nt.BbvCI"

Primers in FASTA format

(Click the FASTA link in the to bar to download the primers in FASTA format).
>FW_gene1_[Tm:56.3]
GGGTTTAAUTCCACCCTATTGAGGCAT
>RV_gene1_[Tm:54.6]
AGGCCAUAGTCAGTTAGGGACTTATCG
>FW_gene2_[Tm:49.5]
ATGGCCUTCTGTAGAGTCAACTTCA
>RV_gene2_[Tm:48.2]
ATACAAUACTTCAAGTGAAAAGTTTT
>FW_gene3_[Tm:60.3]
ATTGTAUACGACAGGGTGCGTGTAC
>RV_gene3_[Tm:60.7]
GGTCTTAAUCAAATGTACCTTGCGCGTGC

Output report:

--------------------------------------
PHUSER (Primer Help for USER) v1.2
output generated: 04-05-2011, 21:46:51
--------------------------------------


input parameters:
-----------------
number of sequences: 3
number of linkers: 0
standard cassette: PacI/Nt.BbvCI
* cassette forward strand: GCTGAGGGTTTAATTAAGACCTCAGC
* cassette reverse strand: CGACTCCCAAATTAATTCTGGAGTCG


overview of the needed primers (5'-3'):
---------------------------------------

forward primer for gene1: GGGTTTAAUTCCACCCTATTGAGGCAT
reverse primer for gene1: AGGCCAUAGTCAGTTAGGGACTTATCG
forward primer for gene2: ATGGCCUTCTGTAGAGTCAACTTCA
reverse primer for gene2: ATACAAUACTTCAAGTGAAAAGTTTT
forward primer for gene3: ATTGTAUACGACAGGGTGCGTGTAC
reverse primer for gene3: GGTCTTAAUCAAATGTACCTTGCGCGTGC

attention: one or more of the designed primers may have undesirable properties
please see "primer details" section


overview of your final construct after cloning:
-----------------------------------------------

 PacI/Nt.BbvCI  gene1  gene2  gene3  PacI/Nt.BbvCI 



graphic overview of DNA fragments and primers:
----------------------------------------------

fusion region and forward primer for joining of PacI/Nt.BbvCI and gene1:

                 TCCACCCTATTGAGGCAT-3'
     5'-GGGTTTAAU
5'-GCTGAGGGTTTAATTCCACCCTATTGAGGCATTGACTGATGCGGGAAGAGATCT[...]-3'

fusion region and related primers for joining of gene1 and gene2:

                                                    TCTGTAGAGTCAACTTCA-3'
                                          5'-ATGGCCU
5'-[...]AGAGTAATACTAGCATGCGATAAGTCCCTAACTGACTATGGCCTTCTGTAGAGTCAACTTCACCACATATGCTGTCTCTG[...]-3'
                                             UACCGGA-5'
                      3'-GCTATTCAGGGATTGACTGA

fusion region and related primers for joining of gene2 and gene3:

                                                 ACGACAGGGTGCGTGTAC-3'
                                       5'-ATTGTAU
5'-[...]GTTGACCAACACCGGAAAACTTTTCACTTGAAGTATTGTATACGACAGGGTGCGTGTACCTACCAAACCTGTTTAAACTA[...]-3'
                                          UAACATA-5'
                    3'-TTTTGAAAAGTGAACTTCA

fusion region and reverse primer for joining of gene3 and PacI/Nt.BbvCI:

5'-[...]ATTTCATAATACGTCCTGCCGCACGCGCAAGGTACATTTGATTAAGACCTCAGC-3'
                                                UAATTCTGG-5'
                         3'-CGTGCGCGTTCCATGTAAAC


primer details:
---------------
click here for detailed descriptions of primer evaluation parameters


primer details for gene1

forward primer: GGGTTTAAUTCCACCCTATTGAGGCAT
* Tm: 56.3C - in optimal region (55-72)?                   ...YES
* GC content is: 50.00% - in optimal region (40-60)?       ...YES
* GC clamp present at 3' end?                              ...YES
* more than 3 G/C out of last 5 bases at 3' end?           ...YES
* risk of primer dimer formation in primer pair?           ...NO
* risk of intra-primer complementarity?                    ...NO
* presence of polyN stretches?                             ...NO

reverse primer: AGGCCAUAGTCAGTTAGGGACTTATCG
* Tm: 54.6C - in optimal region (55-72)?                   ...NO
* GC content is: 45.00% - in optimal region (40-60)?       ...YES
* GC clamp present at 3' end?                              ...YES
* more than 3 G/C out of last 5 bases at 3' end?           ...NO
* risk of primer dimer formation in primer pair?           ...NO
* risk of intra-primer complementarity?                    ...NO
* presence of polyN stretches?                             ...NO

Tm of primers within 2C of each other?                     ...YES


primer details for gene2

forward primer: ATGGCCUTCTGTAGAGTCAACTTCA
* Tm: 49.5C - in optimal region (55-72)?                   ...NO
* GC content is: 38.89% - in optimal region (40-60)?       ...NO
* GC clamp present at 3' end?                              ...YES
* more than 3 G/C out of last 5 bases at 3' end?           ...NO
* risk of primer dimer formation in primer pair?           ...NO
* risk of intra-primer complementarity?                    ...NO
* presence of polyN stretches?                             ...NO

reverse primer: ATACAAUACTTCAAGTGAAAAGTTTT
* Tm: 48.2C - in optimal region (55-72)?                   ...NO
* GC content is: 26.32% - in optimal region (40-60)?       ...NO
* GC clamp present at 3' end?                              ...YES
* more than 3 G/C out of last 5 bases at 3' end?           ...NO
* risk of primer dimer formation in primer pair?           ...NO
* risk of intra-primer complementarity?                    ...NO
* presence of polyN stretches?                             ...YES

Tm of primers within 2C of each other?                     ...YES


primer details for gene3

forward primer: ATTGTAUACGACAGGGTGCGTGTAC
* Tm: 60.3C - in optimal region (55-72)?                   ...YES
* GC content is: 61.11% - in optimal region (40-60)?       ...NO
* GC clamp present at 3' end?                              ...YES
* more than 3 G/C out of last 5 bases at 3' end?           ...NO
* risk of primer dimer formation in primer pair?           ...NO
* risk of intra-primer complementarity?                    ...NO
* presence of polyN stretches?                             ...NO

reverse primer: GGTCTTAAUCAAATGTACCTTGCGCGTGC
* Tm: 60.7C - in optimal region (55-72)?                   ...YES
* GC content is: 55.00% - in optimal region (40-60)?       ...YES
* GC clamp present at 3' end?                              ...YES
* more than 3 G/C out of last 5 bases at 3' end?           ...YES
* risk of primer dimer formation in primer pair?           ...NO
* risk of intra-primer complementarity?                    ...NO
* presence of polyN stretches?                             ...NO

Tm of primers within 2C of each other?                     ...YES


details of final construct after cloning (length: 3028 bases):
--------------------------------------------------------------

 PacI/Nt.BbvCI  gene1  gene2  gene3  PacI/Nt.BbvCI 

1         GCTGAGGGTTTAATTCCACCCTATTGAGGCATTGACTGATGCGGGAAGAGATCTGAAATG
61        AACTGGTCTATGCGACAGAAACTGTGCAGCTACCTAATCTCCTTAGTGTAGGTTCTGACC
121       GATTCGTGCTTCGTTGAGAACTCACAATTTAACAACAGAGGACATAAGCCCTACGCCCAT
181       GATCTACTGACGTCCCTGAGGCTGCAATTCATGTAATGGGACAGTATCCGCGGCAAGTCC
241       TAGTGCAATGGCGGTATTCTACCCTCGTACTGTAGTAGAGGCGACGCGGGTGCGGTCATC
301       ACTAATAAGGATATTGGGAAGACTCACAGGCCTCCGCCTTTAGGCGGTGCTTACTCTTAC
361       ATAAAGGGGCTGTTAGTATTACCCCGCGAGGATTCGAAAAGGTGAGCCAACCCGGCCGAT
421       CCGGAGAGACGGGCCTCAAAGCCGCGTGACGACGGCTGTGGGCCCGTAACAAAATCCCCG
481       CAATAAGCTCCCGTGAGCGTCGGTTGAACAGCCCTGGTCGGCCCCATCAGTAGCCCGAAT
541       ATGTCGCTTTACGGGTCCTGGGCCGGGGTGCGATACCTTGCAGAAATCGAGGCCGTTCGT
601       TAATTCCTGTTGCATTCGTACCGCCTATATTTGTCTCTTTGCCGGCTTATATGGACAAGC
661       ATAGCATAGCCATTTATCGGAGCGCCTCCGTACACGGTATGATCGGACGCCTCGTGAGAT
721       CAATACGTATACCAGGTGTCCTGTGAGCAGCGAAAGCCTATACGCGAGATACACTGCCAA
781       AAATCCGCGTGATTACGAGTCGTGGCAAATTTGGTCTGGCTGTGGTCTAGACATTCCAGG
841       CGGTGCGTCTGCTCTCGGGTGCCTCTAGTGGCTGGCTAGATAGACTAGCCGCTGGTAAAC
901       ACACCATGACCCCGGCTCTCCATTGATGCCACGGCGATTGTTGGAGAGCCAGCAGCGACT
961       GCAAACATCAGATCAGAGTAATACTAGCATGCGATAAGTCCCTAACTGACTATGGCCTTC
1021      TGTAGAGTCAACTTCACCACATATGCTGTCTCTGGCACGTGGATGGTTTAGAGGAATCAG
1081      ATTCAAGTCTGGTTAACCATCAAACAGGTCTTGAGTCTAAAATTGTCGTCTCCTGCGTAC
1141      GAGATGGAAATACTAGGTAACTACAGGGACTCCGACGTTATGTACGTTGCTCCGTCAGAG
1201      GCGCCATTCAGGATCACGTTACCGCGAAAAAAAGGGACCAGGAGCTCTTCTCCCCTGCGG
1261      TCACGTCTATAGAAATTACACCATTAACCCTCCTGAGAACCGGGAGGCGGGAATCCGTCA
1321      CGTATGAGAAGGTATTTGCCCGATAATCAATACCCCAGGCTTCTAACTTTTTCCACTCGC
1381      TTGAGCCGGCTAGGCCTTTCTGCCCGAAGTTTCGATGGACTGGTGCCAACGCGCAGGCAT
1441      AGTTTTAGGAGAATTATTCGGGGGCAGTGACAACCAACATCTCGGGTCCTGCCCAACCGG
1501      TCTACACGCTAATATAGCGAATCACCGAGAACCCGGCGCCACGCAATGGAACGTCCTTAA
1561      CTCCGGCAGGCAATTAAAGGGAACGTATGTATAACGCAAAAAAACAGAAAAATAGGCGAA
1621      TGAATCTTTTCTCTGTGTATCGAAGAATGGCCTCGCGGAGGCATGCGTCATGCTAGCGTG
1681      CGGGGTACTCTTGCTATCCATATGGTCCACAGGACACTCGTTGTTTTCGGATTTACCCTT
1741      TATGCGCCGGTTTTCAGCCACGCTTATGCCCAGCATCGTTACAACCAGACCGATACTAGA
1801      TGTATAAAGTCCGCCATGCAGACGAGACCAGTCGGAGATTACCGAGCATTCTATCAGGTC
1861      GGCGACCACTAGTGAGCTACTGGAGCCGAGGGGTAACCACGATGCCGCTAAGAACCTCTC
1921      GGTCGACGCAAGCGATTACACTCCTGTCACATCATAATCGTTTGCTATTCAGGGGTTGAC
1981      CAACACCGGAAAACTTTTCACTTGAAGTATTGTATACGACAGGGTGCGTGTACCTACCAA
2041      ACCTGTTTAAACTAAGTTCAGACTAGTTGGAAGTGTGTCTAGATCTTAGTTTTCGTCACT
2101      AGAGGGCCCACGCTTTATTTTTATGATCCATTGATCTCCCAGACGCTGCAAGATTTGCAA
2161      CCAGGCAGACTTGGCGGTAGGTCCTAGTGCAGCGGGACTTTTTTTCTATAGTCCTTGAGA
2221      GGAGGAGTCGTCAGTCCAGATACCTTTGATGTCCTGATTGGAAGGACCGTTGGCCCCCCA
2281      CCCTTAGGCAGTGTACTCAGTTCCATAAACGAGCTATTAGATATGAGGTCCGTAGATTGA
2341      AAAGGGTGACGGAATTCGCCCGAACGGGAAAGACGGACAACTAGGTATCCTGAGCACGGT
2401      TGCGCGTCCGTATCAAGCTCCTCTTTATAGGCCCCGGTTTCTGTTGGTCGTAGAGCGCAG
2461      AACGGGTTGGGGGGATGTACGACAATATCGCTTAGTCACCTTTGGGCCACGGTCCGCTAC
2521      CTTACAGGAATTGAGACCGTCCTTTAATTTCCCTTGCATATATGTTGCGTTTCTTCGACC
2581      TTTTAACCGCTCCCTTAGGAGAAAGACAGATAGCTTCTTACCCGTACTCCACCGTTGGCA
2641      GCACGATCGCATGTCCCACGTGAACCATTGGTAAACCCTGTGGCCTGTGAGCGACAAAAG
2701      CTTTAATGGGAAATTCGCGCCCATAACTTGGTCCGAATACGGGTCCTAGCAACGTTCGTC
2761      TGAGTTTGATCTATATAATACGGGCGGTATGTCTGCTTTGATCAACCTCCAATAGCTCGT
2821      ATGATAGTGCACCCGCTGGTGATCACTCAATGATCTGGGCTCCCCGTTGCAACTACGGGG
2881      ATTTTTCGAGACCGACCTGCGTTCGGCATTGTGGGCACAGTGAAGTATTAGCAAACGTTA
2941      AGTCCCGAACTAGATGTGACCTAACGGTAAGAGAATTTCATAATACGTCCTGCCGCACGC
3001      GCAAGGTACATTTGATTAAGACCTCAGC

Primer evaluation parameters

Primer evaluation parameters The assessment of each parameter is highlighted in either green (signifying a positive assessment) or red (signifying a negative assessment) - Please see example output report below. Note that the primer parameters used for optimal primer design is supplied only to evaluate the efficiency of a specific amplification and not the competence of the amplification. Therefore, the lack of positive assessment in any parameter (or all parameters) does not preclude a useful PCR outcome.

Tm of primers: PHUSER ranks the Tm of primers on whether it is in the range 55-72 C. Primers for which the Tm falls in this region are marked with a green "Yes", primers for which the Tm falls outside this region are marked with a red "No".

GC content: The GC content (number of dGTP plus dCTP as a percentage of the total number of nucleic acid residues) should ideally be between 40-60 %, to keep annealing temperature within a favorable range. Primers for which the GC content falls in this region are marked with a green "Yes", primers for which the GC content falls outside this region are marked with a red "No".

Presence of 3' end GC clamp: Due to the stronger annealing of guanine and cytosine with complementary bases, specific binding is promoted by the presence of at least one of either of these bases in the last five bases of the 3' end (GC-clamp). Primers which have 1 or 2 G or C in this region are marked with a green "Yes", primers which have 0 or more than 2 G or C in this region are marked with a red "No".

More than 3 G/C out of last 5 bases at 3' end?: If more than 3 out of the last 5 bases at the 3' end are guanine or cytosine, the binding to the DNA fragment may be too strong. Primers which have less than 3 G or C in this region are marked with a green "No", primers which have 3 or more C in this region are marked with a red "Yes".

Risk of primer dimer formation in primer pair: Stretches of more than five complimentary bases between different primers used in the same PCR can lead to primer dimer formation, which can interfere with the desired hybridization and result in reduced PCR efficiency. With PHUSER the risk of inter-primer homology is assessed based on the relationship between the Tm of the primer and the complimentary bases potentially leading to undesirable dimerization. If the Tm of the potential inter-primer dimerization is at least 10C smaller than that of the annealing temperature used in the PCR cycle, the risk of homology is considered theoretical and the parameter is marked with a green "No", since most of the DNA which could undesirably hybridize is denatured at this higher temperature. If the opposite is the case, the parameter is marked with a red "Yes".

Risk of intra-primer homology (secondary structures): Similarly, stretches of more than three complimentary bases within a primer can lead to formation of intra-primer secondary structures, resulting in reduced PCR efficiency. With PHUSER the risk of intra-primer homology is assessed based on the relationship between the Tm of the primer and the complimentary bases potentially leading to undesirable intra-primer secondary structures. If the Tm of the intra-primer secondary structure formation is at least 10° C smaller than that of the annealing temperature used in the PCR cycle, the risk of homology is considered theoretical and the parameter is marked with a green "No", since most of the DNA which could undesirably hybridize is denatured at this higher temperature. If the opposite is the case, the parameter is marked with a red "Yes".

Presence of PolyN stretches: Sequences consisting of 4 or more consecutive identical nucleotides within the primer are known as polyN stretches; polyG or polyC stretches promote non-specific annealing, whereas polyA or polyT can cause the "opening" of stretches of the primer template complex, referred to as "breathing". If the primers contain stretches of more than 4 consecutive identical nucleotides within a primer, the parameter is highlighted with a red "Yes", if not; the parameter is highlighted with a red "No".

Tm of primers within 2C of each other: For a given primer pair, the primers' Tm should be within 2C of each other, in order to achieve efficient PCR amplification. If this is the case, the parameter is marked with a green "Yes", if not; the parameter is marked with a red "No".

Restrictions on use

Please note that a maximum of 50 jobs can be submitted by each user every 24 hours.



GETTING HELP

Scientific and Technical problems: