Events News Research CBS CBS Publications Bioinformatics
Staff Contact About Internal CBS CBS Other



Output format


DESCRIPTION

For each input sequence the name and length are first printed, followed by a table in the form:

Position Score Likelihood

where 'Position' is a position in the sequence, 'Score' is the prediction score for a transcription start site occurring within 100 base pairs upstream from that position and 'Likelihood' is a descriptive label associated with that score. The scores are always positive numbers; they are labelled as follows:

below 0.5 ignored
0.5 - 0.8 Marginal prediction
0.8 - 1.0 Medium likely prediction
above 1.0 Highly likely prediction

Consult the performance notes for comments on the prediction scores.

The input sequence will be included in the output, preceeding the predictions if "Full output" has been selected.


EXAMPLE OUTPUT


Promoter 2.0 Prediction Results 

INPUT SEQUENCE:

>gi_209811_gb_J01917_ADRCG Adenovirus type 2, complete genome.
CATCATCATAATATACCTTATTTTGGATTGAAGCCAATATGATAATGAGGGGGTGGAGTT
TGTGACGTGGCGCGGGGCGTGGGAACGGGGCGGGTGACGTAGTAGTGTGGCGGAAGTGTG
ATGTTGCAAGTGTGGCGGAACACATGTAAGCGCCGGATGTGGTAAAAGTGACGTTTTTGG
TGTGCGCCGGTGTATACGGGAAGTGACAATTTTCGCGCGGTTTTAGGCGGATGTTGTAGT
AAATTTGGGCGTAACCAAGTAATGTTTGGCCATTTTCGCGGGAAAACTGAATAAGAGGAA
GTGAAATCTGAATAATTCTGTGTTACTCATAGCGCGTAATATTTGTCTAGGGCCGCGGGG
ACTTTGACCGTTTACGTGGAGACTCGCCCAGGTGTTTTTCTCAGGTGTTTTCCGCGTTCC
GGGTCAAAGTTGGCGTTTTATTATTATAGTCAGCTGACGCGCAGTGTATTTATACCCGGT
GAGTTCCTCAAGAGGCCACTCTTGAGTGCCAGCGAGTAGAGTTTTCTCCTCCGAGCCGCT
CCGACACCGGGACTGAAAATGAGACATATTATCTGCCACGGAGGTGTTATTACCGAAGAA
ATGGCCGCCAGTCTTTTGGACCAGCTGATCGAAGAGGTACTGGCTGATAATCTTCCACCT
CCTAGCCATTTTGAACCACCTACCCTTCACGAACTGTATGATTTAGACGTGACGGCCCCC
GAAGATCCCAACGAGGAGGCGGTTTCGCAGATTTTTCCCGAGTCTGTAATGTTGGCGGTG
CAGGAAGGGATTGACTTATTCACTTTTCCGCCGGCGCCCGGTTCTCCGGAGCCGCCTCAC
CTTTCCCGGCAGCCCGAGCAGCCGGAGCAGAGAGCCTTGGGTCCGGTTTCTATGCCAAAC
CTTGTGCCGGAGGTGATCGATCTTACCTGCCACGAGGCTGGCTTTCCACCCAGTGACGAC
GAGGATGAAGAGGGTGAGGAGTTTGTGTTAGATTATGTGGAGCACCCCGGGCACGGTTGC
AGGTCTTGTCATTATCACCGGAGGAATACGGGGGACCCAGATATTATGTGTTCGCTTTGC
TATATGAGGACCTGTGGCATGTTTGTCTACAGTAAGTGAAAATTATGGGCAGTCGGTGAT
AGAGTGGTGGGTTTGGTGTGGTAATTTTTTTTTAATTTTTACAGTTTTGTGGTTTAAAGA


PREDICTED TRANSCRIPTION START SITES:

gi_209811_gb_J01917_ADRCG Adenovirus type 2, complete genome., 1200 nucleotides

  Position  Score  Likelihood
       600  1.063  Highly likely prediction



GETTING HELP

Scientific problems:        Technical problems: