1. Specify the input sequences
Input sequences must be a full or partial genomic DNA sequences in FASTA format.
The first line in the FASTA format has a ">" followed by a sequence identifier
The second and subsequent lines are sequence symbols (DNA bases) with no more than 80 on each line.
Example of an input file with two FASTA sequences:
>AI12345678
AAACAGTAAAGTTTTAATATTTTTTGAATACAAATTTTAAAAACACTTAAAATTTTAAGT
GTTTTTTACTTAAAAATAAAGATGAACTTTAATTCTTATTTGTAACTTTACATAAATTCA
TAAATATGTTTATAAAAATGTTAATAAAATGTAAATTCATTGTAAATTAAAAAAATTAGA
ACAATTTAAATCTTAAATTAATTATAATGATTCCATGAAAAAAGAAATCTTTGATAATAA
The allowed alphabet (not case sensitive) is as follows:
A C G T
All other symbols will be converted to N before processing. The
sequences can be input in the following two ways:
-
Paste one or more DNA sequences in FASTA format into the upper window of the main server page.
-
Select a FASTA
file on your local disk, either by typing the file name into the lower window
or by browsing the disk.
Both ways can be employed at the same time: all the specified sequences will
be processed.
2. Select the input parameters
Specify the origin (kingdom) of your DNA sequence: Bacteria, Archaea, or Eukaryote.
3. Submit the job
Click on the "Submit" button. The status of your job (either 'queued'
or 'running') will be displayed and constantly updated until it terminates and
the server output appears in the browser window.
At any time during the wait you may enter your e-mail address and simply leave
the window. Your job will continue; you will be notified by e-mail when it has
terminated. The e-mail message will contain the URL under which the results are
stored; they will remain on the server for 24 hours for you to collect them.
| 
