Example of two sequences in FASTA format


>seq1
TGAGTGTGAATGGATAAGAGTGAGAGAAACAGTGGACACGTGTGGCAGTTTCTGAGTAGGGTTTCTTTTTGTTTGC
AGGTATCCGGTGTGAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTATAGCCTGGGGGGTCCCTGAGACTCTCC
TGTGCAGCCTCTGGGTTCACCTTTAGCAGCGATGCCATGAGCTGGGCCCGCCAGGCTCCAGGGAAGGGGCTGGAGT
GGGTCTCAGCTATAAGAGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCAGGTTCACCATCTCCAA
AGACAATTCCAAAAACACGCTGTATCTGCAAATGAACAGGCTGAGAGCCTAGGACACGGCCGTGCATTACTGTGCG
TCGGGCGCCAAGGGACCACGGTCACCGTCTCCTCACGT
>seq2 optional comment
TGAGTGTGAATGGATAAGAGTGAGAGAAACAGTGGACACGTGTGGCAGTTTCTGAGTAGGGTTTCTTTTTGTTTGC
AGGTATCCGGTGTGAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTATAGCCTGGGGGGTCCCTGAGACTCTCC
TGTGCAGCCTCTGGGTTCACCTTTAGCAGCGATGCCATGAGCTGGGCCCGCCAGGCTCCAGGGAAGGGGCTGGAGT
GGGTCTCAGCTATAAGAGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGAAGGGCAGGTTCACCATCTCCAA
AGACAATTCCAAAAACACGCTGTATCTGCAAATGAACAGGCTGAGAGCCTAGGACACGGCCGTGCATTACTGTGCG


Please note that empty lines are not accepted.

Detailed description of the FASTA format is available at NCBI.


GETTING HELP

Support,