Output Format


Description




EXAMPLE OUTPUT



VDJsolver 1.0 using the JointMLc algorithm for IgH joint composition (version 060505)

Result for sequence no: 1
>seq1

Rearrangement
GTGCATTACTGTGCGAAGGGGAGGCTAGAGGATCCCGGGGAGCTACTAAAACTACCAAAACAACCATACTACCACTACCACGGCATGGACGTCGGGCGCCAAGGGACCACGGTCACCGTCTCCTCACGT

..at.............aga              <- V-gene: IGHV3-23*01
GTGCATTACTGTGCGAA                         <- VH-segment
                 GGGGAGGCTAGAGGATCCCG             <- N-addition (1)
                                     GGGAGCTACTA          <- D-segment
                             ..tatagt...........c                 <- D-gene: IGHD1-26*01
                                                AAACTACCAAAACAACCA        <- N-addition (2)
                                                 JH-segment ->    TACTACCACTACCACGGCATGGACGTCGGGCGCCAAGGGACCACGGTCACCGTCTCCTCACGT
                                         JH-gene: IGHJ6*02 ->   at......t.....t....t.........t..g.............................g..

Rearrangement conserves reading frame
Number of stopcodons in joint at time of rearrangement= 0
Rearrangement is productive
CDR3 length (bp)= 81






GETTING HELP

Scientific problems:        Technical problems: