Events News Research CBS CBS Publications Bioinformatics
Staff Contact About Internal CBS CBS Other

Output Format


Description




EXAMPLE OUTPUT



VDJsolver 1.0 using the JointMLc algorithm for IgH joint composition (version 060505)

Result for sequence no: 1
>seq1

Rearrangement
GTGCATTACTGTGCGAAGGGGAGGCTAGAGGATCCCGGGGAGCTACTAAAACTACCAAAACAACCATACTACCACTACCACGGCATGGACGTCGGGCGCCAAGGGACCACGGTCACCGTCTCCTCACGT

..at.............aga              <- V-gene: IGHV3-23*01
GTGCATTACTGTGCGAA                         <- VH-segment
                 GGGGAGGCTAGAGGATCCCG             <- N-addition (1)
                                     GGGAGCTACTA          <- D-segment
                             ..tatagt...........c                 <- D-gene: IGHD1-26*01
                                                AAACTACCAAAACAACCA        <- N-addition (2)
                                                 JH-segment ->    TACTACCACTACCACGGCATGGACGTCGGGCGCCAAGGGACCACGGTCACCGTCTCCTCACGT
                                         JH-gene: IGHJ6*02 ->   at......t.....t....t.........t..g.............................g..

Rearrangement conserves reading frame
Number of stopcodons in joint at time of rearrangement= 0
Rearrangement is productive
CDR3 length (bp)= 81






GETTING HELP

Scientific problems:        Technical problems: