1. What is the MOST important contribution to DNA structure & curvature?
2.
If a protein were to bind to the sequence below, where would be a good place to bend the DNA? (please explain your answer!)
5' TGCGGGAAAGTACATTTCGGAATCCCTGATGATATAAGCGCCCGGAGCGATCAAACGATACG 3'
3. Three questions about DNA compaction: A. How much is the DNA compacted in a typical cell? B. How long would the DNA double helix be, for a single human cell? C. What would be the distance of ALL the DNA stretched out in the B-DNA double helical form, for an average person? How many times would this stretch around the earth (circumference = 40,070 km)? How does this number compare with other distances (see "helpful facts below")?
Some helpful facts:
Back to the CBS homepage
Last modified Tuesday, 4 April, 2001 by David Ussery