30431 Introduktion til Bioinformatik
David Ussery
Tirsdag, 17 April, 2001
Link to the lecture notes
Link to the learning objectives

Self-test quiz


   1.    What is the MOST important contribution to DNA structure & curvature?






   2.    If a protein were to bind to the sequence below, where would be a good place to bend the DNA? (please explain your answer!)

5' TGCGGGAAAGTACATTTCGGAATCCCTGATGATATAAGCGCCCGGAGCGATCAAACGATACG 3'






   3.    Three questions about DNA compaction: A. How much is the DNA compacted in a typical cell? B. How long would the DNA double helix be, for a single human cell? C. What would be the distance of ALL the DNA stretched out in the B-DNA double helical form, for an average person? How many times would this stretch around the earth (circumference = 40,070 km)? How does this number compare with other distances (see "helpful facts below")?

Some helpful facts:

    * Humans have about 3,000,000,000 bp of DNA per genome.
    * The rise in the B-DNA helix is very close to 0.34 nm per bp.
    * 1 nm = 1x10-9 meters
    * Remember that humans have TWO copies of chromosomes per cell!
    * An average human contains about 0.5 grams of DNA.
    * Assume that DNA weighs about 1x10-21 grams/bp
    * The distance from the earth to the moon is 382,000,000 meters.
    * 1 Astronomical Unit ("AU", the distance from the earth to the sun) is 149,600,000,000 meters







DNA helix



Go to the CBS Home Page Back to the CBS homepage
Back to Dave's Courses page

Last modified Tuesday, 4 April, 2001 by David Ussery