100 points Total, 10 points per question.

Lecture # 10 - Chapter 9 - Cellular Reproduction

 1. (10 pts.) Draw a picture of a cell that undergoes mitosis.  If the cell has 2n chromosomes at the beginning, what would be the number of chromosomes in each cell AFTER meiotic division?
 
 
 
 
 
 

Lecture # 11 - Chapter 10 - DNA is like Coca-cola

2 a. (6 points) What are the three main components of RNA, other than water?
 
 Component # 1 ___________

Component # 2 ____________

Component # 3  ____   ____   ____   ____
 
 
 

2 b. (4 pts.) Why is DNA called "the transforming agent"?
 
 
 
 

Lecture # 11 Ch. 12 - Gene Expression & Regulation

3. (10 pts.)  What is the "Central Dogma" of molecular biology?
 
 
 

 
 
4. Provide the information for the following sequence:

5' GATCTAGGACTATCGATGATCTAGTACGTACTGAGGGTACTAGAAT3'

a. (5 pts.) What is the sequence of the other strand of DNA?
(to get full credit, the sequence must be written in the correct order)
 

b. (5 pts.) What is the sequence of the complimentary strand of RNA?
 
 
 
 

5a. (5 pts.) Starting with the 5' end of the following sequence, "translate" the RNA into a protein:

5' AUGCUAGGACUAUCGAUGAUCUAGUACGUACUGAGGGUACUA 3'
 
 
 

 b. (5 pts.) What would be the "new" protein if you inserted a "G" into position # 6 (between the A & G)?
 
 
 
 
 
 

Lecture # 13 Ch. 12 - Gene Exchange, Meiosis, and Eukaryotic Life Cycles

6. (10 pts.) Draw a picture of a cell that undergoes meiosis.  If the cell has 2n chromosomes at the beginning, what would be the number of chromosomes in each cell AFTER meiotic division?
 
 
 
 

 

 
 

Lecture # 14 Chapter 13 - Patterns of Inheritance

7. You mate a purple plant with a white plant, and all the progeny (F1) are purple.  Upon mating these "F1s" with each other, you obtain the following numbers: 753 purples, 249 whites.  Please explain these results, in terms of simple Mendelian genetics.  What ratio might you expect if you have a dominant and recessive single-allele trait?
 

8.  You mate a "Tall" (TT) plant with a short plant (tt)
 a. (5 pts.) What are the F1 phenotypes?
 
 

b. (5 pts.) What are the F2 phenotypes?
 
 
 
 

Lecture # 15 Chapter 14 - Molecular Genetics and Biotechnology

9.  Why are so many people concerned about adding growth hormones to milk?
 
 
 
 
 

Lecture # 16 Chapter 15 - Human Genetics
 
10.  Briefly explain what the human genome project is, and what is its ultimate goal.  What ethical issues might result from this project?
 
 
 
 

Extra Credit:
There are many hypothesis, but as yet no definitive answers, to the question, "Why does the Y chromosome carry so few genes?"  Discuss the disadvantages of a Y chromosome lacking most of the genes carried on the X chromosome in the light of your knowledge of dominance and recessiveness, and the protective effect of diploidy.