Biology 210
GENETICS
11 February, 1998
1m025.gif
Chapter 5c
The Molecular Structure and Replication
of the Genetic Material
-or-
Commonly Used METHODS for the
Characterisation of DNA Sequences
 1m026.gif
 
A Brief Outline

Method # 1: Absorbance of DNA

Method # 2: DNA micro-chip technology

Method # 3: Gel Electrophoresis
 
 

 
 Leaf 65

The discussion will still follow (kind of) the outline from the text:

5.7 The Isolation & Characterisation of
        Particular DNA Fragments

5.8 The Polymerase Chain Reaction

5.9 Determination of the Sequence of
        Bases in DNA


 



 
5.7 The Characterisation of DNA
 
Method # 1: Absorbance of DNA
(NOTE: this was covered in the last part of the lecture on Wednesday)

First, a few words about the UV Absorbance of DNA, and how you can easily monitor whether the DNA is double-stranded or single-stranded (or even triple-stranded for that matter, but this is a topic for another lecture...)

This is kind of an ugly picture of double-stranded DNA (scanned in from my lab notebook), but you can see that the peak is very close to 260 nm. (Actually, very pure DNA should have a lambda max. around 257 nm.)
 

pBluescript DNA absorption spectrum
 
The absorbance is very close to 1.0, and, since the DNA was diluted 1:20, the original concentration of the DNA is about 1 mg/ml (it was diluted to be this way - this is a "stock" solution of DNA).

How do I know what the concentration is?
 
 

An A260 of 1.0 = 50 mg/ml concentration of DNA. 
Since I diluted this by a factor of 20, then 20*50=1000 mg/ml or 1 mg/ml.



Some numbers for determing the concentration of DNA, based on the absorbance at 260 nm:
 
 
For DOUBLE-STRANDED DNA
An A260 of 1.0 = 50 mg/ml 
concentration of DNA
 Extinction coefficient, e260 = 6100 mol-1l-1
 

 
For Single-stranded DNA
 dNMP
e260 
MW
MW - 18g
(for water)
A
15200
331.23
313.22
T
8400
322.21
304.20
G
12010
347.23
329.22
C
7050
307.20
289.19
 
 To get the extinction coeficcient for an oligomer (for example, a primer), you simply add up the e260's for all the nucleotides present.  So, for the primer shown below:
5' CCTTTTAAAACGTTTTAAAAG 3'
 
 
e260= 233,970 mol-1l-1
The absorption spectra of this primer is shown below; at 260 nm, the absorbance was 0.4398.  What is the concentration of DNA, in mg/ml?  What is the concentration in moles of oligomer per liter? Please try and do this on your own before you look at the answers below.
 


 
[DNA] = 290 mg/ml
[oligomer] 37.6  m 
( 37.6 micromoles of 
oligomer per liter)

DNA Absorbance and melting of the double strand

The Absorbance of DNA increases as it melts

Figure 5.28, page 200 in Hartl & Jones
Figure 5_28

 



 

Different organisms have different G+C contents...

 

This difference in G+C can be seen in the densities of different DNA:

 

And the %G+C is also seen by different melting curves:


For Bacteria, the melting curves are all pretty much the same, except for the difference due to G+C content.  However, the melting curves for eukaryotes can be quite different, as can be seen by a comparison of E.coli DNA with DNA extracted from a cow.

This difference in melting curves (actually, renaturation curves) is due to the presence of repetative sequences within the genome of cow DNA.  By melting the DNA and then measuring the rate of renaturation, it is possible to estimate the complexity of the genome for the cow (or whatever other organism you want...)
 

Figure 6.18 (page 239 from Hartl & Jones)
Figure 6.18 from Hartl & Jones, 1998


.

 

This analysis was extended to many different types of organisms, with the following (now famous) result:

Figure 6.17 (page 238 from Hartl & Jones)
Figure 6.17 from Hartl & Jones
 

Leaf bar # 20

Method # 2: DNA micro-chip technology
 
Recently, small DNA oligomers have been attached to micro-chips, and used to probe for the presence of complimentary DNA in bacteria by hybridization.  Here is an abstract for a recent article.
 

Nat Biotechnol 1998 Jan;16(1):45-48 

Bacterial transcript imaging by hybridization of total RNA to oligonucleotide arrays. 

de Saizieu A, Certa U, Warrington J, Gray C, Keck W, Mous J 

Pharma Division, F. Hoffmann-La Roche Ltd., Basel, Switzerland. 
 

We have used high-density oligonucleotide probe arrays (chips) for bacterial 
transcript imaging. We designed a chip containing probes representing 106 
Hemophilus influenzae genes and 100 Streptococcus pneumoniae genes. The 
apparent lack of polyadenylated transcripts excludes enrichment of mRNA by 
affinity purification and we thus used total, chemically biotinylated RNA as 
hybridization probe. We show that hybridization of Streptococcus RNA to a chip allows simultaneous quantification of the transcript levels. The sensitivity was found to be in the range of one to five transcripts per cell. The quantitative chip results were in good agreement with conventional Northern blot analysis of 
selected genes. This technology allows simultaneous and quantitative measurement 
of the transcriptional activity of entire bacterial genomes on a single 
oligonucleotide probe array. 

PMID: 9447592, UI: 98108853 

 

Leaf 39

These arrays have been postulated to be capable of analysis of complete genomes:
 

Bioessays 1996 May;18(5):427-431 

Genome analysis with gene expression microarrays. 

Schena M 

Department of Biochemistry, Beckman Center, Stanford University Medical 
Center, CA 94305-5307, USA. schena@cmgm.stanford.edu 

Advances in biochemistry, chemistry and engineering have enabled the development of a new gene expression assay. This 'chip-based' approach utilizes microscopic arrays of cDNAs printed on glass as high-density hybridization targets.  Fluorescent probe mixtures derived from total cellular messenger RNA (mRNA) hybridize to cognate elements on the array, allowing accurate measurement of the expression of the corresponding genes. Array densities of > 1,000 cDNAs per cm2 enable quantitative expression monitoring of a large number of genes in a single hybridization. A two-color fluorescence detection scheme allows rapid and simultaneous differential expression analysis of independent biological samples. Mass-produced microarrays provide a new tool for genome expression analysis that may revolutionize genetic dissection, drug discovery and human disease diagnostics. 

Publication Types: 

     Review 
     Review, tutorial 

PMID: 8639166, UI: 96220674 

 


Here's a picture of a "DNA chip"
Photolithographic techniques inspired by the semiconductor industry are the basis for preparing high-density oligonucleotide arrays. Shown here is a 1.28x1.28­cm array of more than 10,000 different nucleotide sequences (probes), which was then incubated with a cloned fragment (the target) from the genome of the HIV-1 virus. If the fluorescently labeled target contained a region complementary to a sequence in the array, the target hybridized with the probe, the extent of the hybridization depending on the extent of the match. This false-color image depicts different levels of detected fluorescence from the bound target fragments. Techniques such as this may ultimately be used in sequencing applications, as well as in exploring genetic diversity, probing for mutations, and detecting specific pathogens. Photo courtesy of Affymetrix.  

Link to the page this came from: 
http://www.lbl.gov/Publications/TKO/07_beyond.html

 
 

How can they possibly make such a fine grid with DNA oligomers?

One way is to use a GRIDDER robot, such as this one from the Sanger centre in England (that's why "center" is spelt funny!)
 
 
Gridding on the Flexible Robot
 

What Is It...? 

The gridder makes high density arrays (grids) of spots onto nylon membrane filters. These spots can be cosmid, YAC, BAC or DNA. High density arrays mean that several microtitre plates can be represented on a single 80mm x 128mm filter, e.g. with a 4x4 pattern 16 plates are condensed onto a single filter. 

(I guess I should give a few definitions, since we haven't covered this yet in lecture -  a cosmid is a large piece of viral DNA, YAC = Yeast Artificial Chromosomes;  BAC = Bacterial Artificial Chromosomes)

Here is an extract of a 6x6 pattern using a 96-pin tool. The pattern only contains 32 spots rather than the maximum 36, the missing spots are used to make the pattern easier to read. 
 

How Does It Do It...?

The gridder is built on the Flexible Robot platform. The set up looks something like this: 

  

Here you can see the 96-pin tool on the end of the Z axis and two freezer trays on the bed of the robot, one holding master plates, the other holding output filters. To the right of the freezer trays is a fixture holding an ethanol bath for sterilisation. 
 
 

The gridder uses a tool comprising 96 or 384 floating pins. These are arranged on 9mm or 4.5mm centres to suit standard plasticware. The pins are guided by two PTFE loaded nylon guide plates to provide the accurate guiding and low friction needed to produce high quality, high density patterns. 

This is what it looks like...you can see the 96 floating pins and the filters. 
 

Where Can I Get One...?

If you're from the Sanger Centre or any of the other institutions on the Hinxton Hall site then come down to the Engineering Group in the workshop. 

If you're looking at this from a site other than Hinxton Hall then contact PBA Technology via their web page.

 home The Engineering Group home page 

 homeThe Sanger Centre home page 


Rob Davies (rmd@sanger.ac.uk)
Last Update 16 July 1996
 
 
 

This technology has now allowed for the rapid evolutionary analysis within different organisms:
 

[Genetics]
Volume 18 Number 2 - February 1998 

letters 

Evolutionary sequence comparisons using high-density oligonucleotide arrays  
Joseph G. Hacia1, Wojciech Makalowski2, Keith Edgemon1, Michael R. Erdos1, Christiane M. Robbins1, Stephen P. A. Fodor3, Lawrence C. Brody1 & Francis S. Collins1 

1National Human Genome Research Institute, Building 49/3A14, National Institutes of Health, Bethesda, Maryland 20892, USA. 2National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, Maryland 20892, USA. 3Affymetrix, 3380 Central Expressway, Santa Clara, California 95051, USA. Correspondence should be addressed to F.S.C. e-mail: fc23a@nih.gov  

We explored the utility of high-density oligonucleotide arrays (DNA chips) for obtaining sequence information from homologous genes in closely related species. Orthologues of the human BRCA1 exon 11, all approximately 3.4 kb in length and ranging from 98.2% to 83.5% nucleotide identity, were subjected to hybridization-based and conventional dideoxysequencing analysis. Retrospective guidelines for identifying high-fidelity hybridization-based sequence calls were formulated based upon dideoxysequencing results. Prospective application of these rules yielded base-calling with at least 98.8% accuracy over orthologous sequence tracts shown to have approximately 99% identity. For higher primate sequences with greater than 97% nucleotide identity, base-calling was made with at least 99.91% accuracy covering a minimum of 97% of the sequence. Using a second-tier confirmatory hybridization chip strategy, shown in several cases to confirm the identity of predicted sequence changes, the complete sequence of the chimpanzee, gorilla and orangutan orthologues should be deducible solely through hybridization-based methodologies. Analysis of less highly conserved orthologues can still identify conserved nucleotide tracts of at least 15 nucleotides and can provide useful information for designing primers. DNA-chip based assays can be a valuable new technology for obtaining high-throughput cost-effective sequence information from related genomes. 
 


Nature Biotechnology Medicine Structural Biology Buyers' Guide 
Copyright 1997 Nature America Inc. Send comments to webmaster@us.nature.com 
 
 
 
 

Here's an advertisement for a company, using DNA chip technology:
 
High Throughput Gene Expression Analysis:
 Customized screening for expression levels of up to 100,000 genes on high density arrays, using diseased tissues, normal tissues and cell lines.  
click here for a link to Lifespans homepage
 
Leaf bar # 17

Method # 3: Gel Electrophoresis

Gel electrophoresis allows for the seperation of DNA molecules based on their size.
Figure 5_33



Most of the time, the DNA is stained with Ethidium bromide, and then visualised with UV light.  Here is a typical example of a gel.  Notice that the smaller samples will run faster.  Notice also that the bands lower in the gel are less intense- this is simply because there's LESS DNA in the smaller bands (there's the same number of molecules, but each molecule is smaller, so the TOTAL AMOUNT of DNA is less.)
Figure 14_19 from Griffiths et al., 1996
 
 
 

Leaf 40
Restriction Enzymes

Restriction enzymes cut DNA at specific sequences.  Here's a few examples...
Table 14_1 from Griffiths et al., 1996

Leaf 59

Restriction mapping:

these enzymes can be used to map a given DNA sequence
Figure 14_30 from Griffiths et al., 1996

Leaf 57

Southern Blots

Figure 5_35 from Hartl & Jones, 1998 (page 207)
First, you run a "normal" DNA gel
(usually agarose, but it doesn't HAVE to be).
then you hybridise the DNA onto a membrane
Figure 5_35a
 
Next, this membrane is soaked in a mixture containing
radioactively labelled probe, which should hybridize
Figure 5_35b
 
The the filter is washed and exposed to radioactive film.
Figure 5_35c
 
Leaf 36
A more detailed picture from Griffiths et al., 1996:

note that you can also use fluorescently labelled DNA - it does not HAVE
to be radioactively labelled!
Figure 14_20 from Griffiths et al., 1996
 note that your DNA is a smear, because you have lots of different fragments - you want to only see a few bands (hopefully) with your probe.

To transfer the DNA from the gel to the membrane, usually a "sandwich" is made as follows:
Figure 14_20 from Griffiths et al., 1996
 

The gel is usually then thrown away.  I like to use pre-stained markers, so I can make sure that the DNA transfers to the filter.
Figure 14_20 from Griffiths et al., 1996
 

The "Seal-a-Meal" bag is not essential, but you certainly want to be careful not to leak radioactive stuff all over the lab!!  Sometimes the filter will be put in a "roller bottle" and then hybridised in an oven.  I think the oven kind of looks like a "hot dog cooker".

Figure 14_20 from Griffiths et al., 1996
 

FINALLY, you remove the liquid containing the probe, and (carefully) wash the membrane.  Hopefully you'll see some bands on the film (next step).
Figure 14_20 from Griffiths et al., 1996
 

Usually the membrane is exposed to film overnight or so....
Figure 14_20 from Griffiths et al., 1996
 

Leaf 28

Here is a typical example of a Southern blot.  YES, it looks ugly.  Most of the time they look this ugly or worse!  But, the important thing is that you can see your bands, so to the poor person who did this experiment, it probably looks "beautiful"!
Figure 14_21 from Griffiths et al., 1996
 

Leaf 12
 
 

Here is a simple description of Southern, Northern, and Western blots:
Type of blot Substrate Probe
Southern DNA piece of DNA 
(single-stranded)
Northern RNA piece of DNA or RNA 
(single-stranded)
Western Protein Antibody (usually)
 
 

Leaf 25

5.8 The Polymerase Chain Reaction

Figure 5.36 in Hartl & Jones, 1998 (page 209).
Figure 5_36
 

There are may different types of PCR, including the use of reverse transcriptase to make a DNA from an RNA molecule, ("RT-PCR") but these will be the topics of future discussion....

Leaf 45
5.9 Determination of the Sequence of
        Bases in DNA

Here is a EXCELLENT link for
METHODS of DNA isolation and sequencing

Presently there are three - no, FOUR (maybe FIVE) methods for DNA sequencing:


These are listed roughly in their order of development - the first two first became widely avaliable in the late 1970's - both Fred Sanger (at the MRC in England) and Walter Gilbert (at Harvard) got the Nobel prize for this.  However, Sanger's method is faster and the gels look a bit nicer, so not very many people still use the Maxam Gilbert method.  For some DNA sequences (particularly if they're GC rich) it is necessary to resort to Maxam Gilbert Sequencing - but this is quite rare.  The AUTOMATED sequencing machines basically use the Sanger dideoxy method, only fluorescently labelled dideoxy bases are used, allowing all four nucleotides to be put in the same lane.

Leaf 50

    The advances in methodologies can be seen in the increase in sequencing power.  The human genome is roughly 3,000,000,000 bp long.  Below is a table where I have very roughly estimated the length of time it would take to sequence the human genome, based on the number of bp that have been sequenced in a given year.
 

A Timeline of The Human Genome
YEAR
# human genes mapped to a definite chromosome location
# years it would take to sequence the human genome
1967
none
 
sequencing not possible yet
1977
3 genes mapped 
4,000,000 years to finish at 1977 rate
1987
12 genes mapped 
1000 years to finish at 1987 rate
1997
30,000 genes mapped 
50 years to finish at present rate
 NOTE: The genome project is actually ahead of schedule, and it is very likely that the first complete sequence of a human genome will be finished within 3 or 4 years from now (probably during the year 2001).  This is based on an article by Richard A. Gibbs ("Hares and tortoises in the race to sequence the human genome: expectations and realities", Trends in Genetics, 13:381-383, (October, 1997)).
 
leaf 41
 
 The human genome project has also had a major influence on the rest of biology, as other organisms are being sequenced as goals towards the ambitious end of the 3,000,000,000 bp (or so) nucleotide sequence for the human genome.  In particular, the sequencing of complete bacterial genomes is revolutionising the field of microbiology.   Presently, bacterial genomes are being sequence at a rate of slightly faster than one new genome every month!  As technology improves, this rate will increase.  It is estimated that within the next two years, we will know the complete genomic sequence of most major pathogenic bacteria.
 
Organisms sequenced
Year
# genomes sequenced
1994
0
1995
2
1996
4
1997
8 (est.)
1998
30 (est.)
Reference: Tang,C.M., Hood,D.W., Moxon,E.R., "Haemophilus influence: the impact of whole genome sequencing on microbiology", Trends in Genetics, 13:399-404, (1997).

 

Link to a more recent list of sequenced genomes

Link to lecture notes from Autumn 1999





Now a bit more about each method of sequencing:

1. Maxam & Gilbert's method (chemical cleavage)

Figure 14-22 from Griffiths et al., 1996
 

Figure 14-22 from Griffiths et al., 1996
 
 

Figure 14-22 from Griffiths et al., 1996
 

Yes, the Maxam Gilbert gels often will look this ugly!

Maxam-Gilbert
Leaf 67

2. Fred Sanger's method (dideoxy method)

Figure 5_38
 

Figure 5-39
 
Figure 5-39
Figure 5-39
 
 
Figure 5-39

Leaf 38

Figure 14_25 from Sanger et al., 1996

Click here for a sample protocol for CHEMILUMINESCENT DNA SEQUENCING

Leaf 34

3. AUTOMATED sequencing (dideoxy, using fluorescent tags)
 

Figure 14_27 from Griffiths et al., 1996
 

Leaf 64

4. DNA-chip sequencing (currently being developed)

This is best described in an article from the New York Times, almost a year ago! (April, of 1997).  Click on the image for a link to the article.  Also, I've copied an abstract of a recent article on this technology:
 
 
Link to Pub-Med

Genome Res 1997 Jun;7(6):606-614 

Minisequencing: a specific tool for DNA analysis and diagnostics on oligonucleotide arrays. 

Pastinen T, Kurg A, Metspalu A, Peltonen L, Syvanen AC 

Department of Human Molecular Genetics, National Public Health Institute, 
Helsinki, Finland. 

We describe a method for multiplex detection of mutations in which the 
solid-phase minisequencing principle is applied to an oligonucleotide array format. 
The mutations are detected by extending immobilized primers that anneal to their 
template sequences immediately adjacent to the mutant nucleotide positions with 
single labeled dideoxynucleoside triphosphates using a DNA polymerase. The 
arrays were prepared by coupling one primer per mutation to be detected on a 
small glass area. Genomic fragments spanning nine disease mutations, which were 
selected as targets for the assay, were amplified in multiplex PCR reactions and 
used as templates for the minisequencing reactions on the primer array. The 
genotypes of homozygous and heterozygous genomic DNA samples were 
unequivocally defined at each analyzed nucleotide position by the highly specific 
primer extension reaction. In a comparison to hybridization with immobilized 
allele-specific probes in the same assay format, the power of discrimination 
between homozygous and heterozygous genotypes was one order of magnitude 
higher using the minisequencing method. Therefore, single-nucleotide primer 
extension is a promising principle for future high-throughput mutation detection 
and genotyping using high density DNA-chip technology. 

PMID: 9199933, UI: 97343328 

 

Friez 34

5. Sequencing of individual bases (at the atomic level!)
 

Leaf 51  
 
 
Sequencing based on the detection of fluorescence from single molecules is being pursued at Los Alamos. The strand of DNA to be sequenced is replicated using nucleotides linked to a fluorescent tag -- a different tag for each of the four nucleotides. The tagged strand is then attached to a polystyrene bead suspended in a flowing stream of water, and the nucleotides are enzymatically detached, one at a time. Laser-excited fluorescence then yields the nucleotide sequence, base by base. Much development remains to be done on this technique, but success promises a cheaper, faster approach to sequencing, one that might be applicable to intact cosmid clones 40,000 bases long. 
Link to the page this came from:
http://www.lbl.gov/Publications/TKO/07_beyond.html
 

Leaf 48

 

 
Alaskan Victim of 1918 Flu Yields Sample of Killer Virus (11-Feb-98)

leaf 41

Back Back to the GENETICS Syllabus  Chromosome icon

Leaf 68



Last modified on: 1 February, 2000 by Dave Ussery