Biology 210
20 February, 1998

Leaf 65

Chapter6d

The Structure of Eukaryotic Chromosomes
Part 3: DNA Curvature
in chromatin and chromosomes

leaf 41



A Brief Outline

This is continued from Last Friday's lecture:

I. The Problem: DNA Compaction

This first part was covered in last Friday's lecture!

The rest of this will be today's lecture (Friday, 20-Feb-98) II. What IS "curved DNA"? III. On the Biological Significance of curved DNA  

Friez 34
II. What IS "curved DNA"?
 

Certain sequences of DNA will form a "static curve", where the DNA follows a particular 3-dimensional path.  Thus, instead of just being in the normal B-DNA conformation ("straight"), the piece of DNA shown below can form a flat, planar curve such that about 126 bp will fold back on itself. 126 bp pieces of A5A6 curved DNA

Curved DNA is the only DNA conformation that I am aware of that was not really PREDICTED, but discovered by accident!  In terms of biological "usefullness", it seems to be one of the most significant structures, in terms of DNA compaction and gene expression.  (This will be discussed in the last section.)
 

THE DISCOVERY of curved DNA



Curved DNA was first discovered by the anomalous migration of a piece of DNA from mitochondrial kinetoplast (the 490 bp piece labelled "kDNA" in the figure).  The observation was that the apparent size of the fragment depended on the percent of acrylamide used in the gel (the size is determined relative to the markers).  Notice that in an 8% acrylamide gel, the 490 bp piece of DNA runs as if it is more than 1000 bp long! This figure is from the paper of Marini, et al., 1982 ("Bent helical structure in kinetoplast DNA", Proc. Natl. Acad. Sci. USA, 79: 7664-7664).


There are 3 METHODS commonly used to analyse DNA curvature:



Method #1: Gel Electrophoresis

Marini et al. proposed that the reason for the anomalous migration in acrylamide gels was due to a stable curvature of the DNA helix. In agarose gels, the pore size is quite large, but in acrylamide gels, it can be actually be as little as an average of about 1.5 nm for a 20% acrylamide gel - this is LESS than the width of the double helix (2 nm).  We often use a 20% acrylamide gel to seperate out small pieces of single-stranded DNA. 






What is it about the kinetoplast DNA that makes it curved?

One striking observation about the kDNA sequence was the presence of runs of about 4 or 5 A's (or T's), spaced about 5 bp apart.  Here's part of the original kinetoplast DNA sequence, from a "GenBank" report:
 
LOCUS       MICFMNC3      250 bp    DNA   circular  INV       06-JUL-1989 
DEFINITION  Critidia fasciculata kinetoplast minicircle DNA bent helical 
            region pos. 2291 to 2515 and 1 to 15 of minicircle majority 
            sequence class. 
ACCESSION   X04483 M20272 
NID         g12866 
KEYWORDS    circular; minicircle. 
SOURCE      Crithidia fasciculata. 
  ORGANISM  Kinetoplast Crithidia fasciculata 
            Eukaryotae; mitochondrial eukaryotes; Euglenozoa;  
            Kinetoplastida; Trypanosomatidae; Crithidia. 
REFERENCE   1  (bases 1 to 250) 
  AUTHORS   Ray,D.S., Hines,J.C., Sugisaki,H. and Sheline,C. 
  TITLE     kDNA minicircles of the major sequence class of C. fasciculata 
            contain a single region of bent helix widely separated from 
            the two origins of replication 
JOURNAL     Nucleic Acids Res. 14 (20), 7953-7965 (1986) 
MEDLINE     87040766 
REFERENCE   2  (bases 28 to 30) 
  AUTHORS   Ray,D. 
  TITLE     Direct Submission 
  JOURNAL   Submitted (26-MAR-1987) to the EMBL/GenBank/DDBJ databases 
COMMENT     The author describes 3 dA tracts and further 16 dA tracts in  
            the complementary strand. 
            Data kindly reviewed (26-MAR-1987) by D.S. Ray. 
FEATURES             Location/Qualifiers 
     source          1..250 
                     /organism="Crithidia fasciculata" 
                     /kinetoplast 
                     /strain="Cf-C1" 
                     /db_xref="taxon:5656" 
     misc_feature    1..250 
                     /note="minicircle bent helical region" 
     old_sequence    28..30 
                     /note="tca was tga in [1]" 
                     /citation=[1] 
BASE COUNT       47 a     46 c     54 g    103 t 
ORIGIN  

  1 cagactctaa agcagatgcg tagacgttca gattttgatt tttgagtgcg tttttggcca 
 61 ttttttgccc atttttccct taaaattcaa taaaattgcg ggatttttta ccatttttgt 
121 cgatttttgg ggtattttcg ctgttttttg gcattttttg gccatttttc cttgattttg 
181 ggcacttttc gggctccaaa aaagtaacct cgcgattttc gcctggaatt ttaggcctcc 
241 tggcaggggg  
// 
 




Question # 1 - Were the A-tracts important? To answer this question, several simple experiments were done with small oligomers.  In the first experiment, a set of 30 bp oligomers were made, and then ligated to each other.
 
 

Sequence
# A tracts
5' AAAAAGCGTAAAAAGCGTAAAAAAGCGT 3'
3/3 (1/1)
5' GCGATACGGTAAAAGCGTAAAAAAGCGT 3'
2/3
5' GCGATACGGTAAAAAGCGTGCGATCGGT 3'
1/3





Method #2: Electron Microscopy




Method #3: Cyclisation Kinetics







B.   Models for intrinsic DNA curvature

Wedge model

This figure was from a review article "20 years of DNA bending", by Wilma Olson & Victor Zhurkin (see references below).


Is this a 6 or a 9??







III. On the Biological Significance of curved DNA

psbA2 Sequence Figure 1


 
   DRE curve
 

A4T4 vs. temperature

pre-melting transition
 
 


 
 


 
 
 
 
 
 
 


 
 


 

References for DNA Curvature and Bending

Many of the pictures and the basic outline used in this lecture came from the following review:

Sinden, R.R., Pearson, C.E., Potaman, V.N., and Ussery, D.W., "DNA: Structure and Function" - part B, pages 15-34. In Advances in Genome Biology. V R.D., ed. (in press, January, 1998). (Handout avaliable on request.)
 

A few good papers on DNA curvature:

* 1. Agrawal, G. K., Asayama, M., and Shirai, M. (1997). A novel bend of DNA cit - changeable bending-center sites of an intrinsic curvature under temperature conditions. FEMS Microbiol Lett 147: 139-145.

2. Calladine, C.R., Collis, C.M., Drew, H.R., and Mott, M.R., A study of electrophoretic mobility of DNA in agarose and polyacrylamide gels. J Mol Biol, 221: 981-1005, (1991).

  3. Calladine, C.R. and Drew, H.R., Understanding DNA - The Molecule & How It Works, ( San Diego: Academic Press, 1992). There's now the 2nd edition of this excellent book (1997), written by a Professor of Structural Mechanics (Chris Calladine) and an expert in X-ray crystallography of DNA (Horace Drew).

4. Calladine, C.R. and Drew, H.R., A useful role for static models in elucidating the behavior of DNA in solution. J, 257: 479-485, (1996).

5. Cress, W.D. and Nevins, J.R., A role for a bent DNA-structure in e2f- mediated transcription activation. Mol Cell Biol, 16: 2119-2127, (1996).

6. Dlakic, M. and Harrington, R.E., The effects of sequence context on DNA curvature. Proc Natl Acad Sci USA, 93: 3847-3852, (1996).

* 7. Evilia, C. and Lu, P., DNA-structure at promoters. FASEB Journal, 10: 2849, (1996).

8. Fitzgerald, D.J., Dryden, G.L., Bronson, E.C., Williams, J.S., and Anderson, J.N., Conserved patterns of bending in satellite and nucleosome positioning RNA. J Biol Chem, 269: 21303-21314, (1994).

9. Gabrielian, A. and Pongor, S., Correlation of intrinsic DNA curvature with DNA property periodicity. FEBS Lett, 393: 65-68, (1996).

10. Gabrielian, A., Simoncsits, A., and Pongor, S., Distribution of bending propensity in DNA-sequences. FEBS Lett, 393: 124-130, (1996).

11. Goodsell, D.S. and Dickerson, R.E., Bending and curvature calculations in B-DNA. Nucl Acids Res, 22: 5497-5503, (1994).

12. Gross, S., Gase, K., and Malke, H., Localization of the sequence- determined DNA bending center upstream of the streptokinase gene skc. Archives Of Microbiology, 166: 116-121, (1996).

13. Haran, T.E., Kahn, J.D., and Crothers, D.M., Sequence elements responsible for DNA curvature. J Mol Biol, 244: 135-143, (1994).

14. Kralovics, R., Fajkus, J., Kovarik, A., and Bezdek, M., DNA curvature of the tobacco grs repetitive sequence family and its relation to nucleosome positioning. J Biomol Struct Dyn, 12: 1103-1119, (1995).

* 15. Marilley, M. and Pasero, P., Common DNA structural features exhibited by eukaryotic ribosomal gene promoters. Nucleic Acids Res, 24: 2204-2211, (1996).

16. Matsushita, C., Matsushita, O., Katayama, S., Minami, J., Takai, K., and Okabe, A., An upstream activating sequence containing curved DNA involved in activation of the Clostridium perfringens plc promoter. Microbiology, 142: 2561-2566, (1996).

* 17. Nickerson, C.A. and Achberger, E.C., Role of curved DNA in binding of Escherichia coli RNA-polymerase to promoters. Journal Of Bacteriology, 177: 5756-5761, (1995).

* 18. Olson, W.K. and Zhurkin, V.B. Twenty Years of DNA Bending. In Biological Structure and Dynamics, Proceedings of the Ninth Conversation. R.H. Sarma and M.H. Sarma, eds. (New York: Adenine Press), pp. 341-370.(1996).

* 19. Perez-Martin, J., Rojo, F., and De Lorenzo, V., Promoters Responsive to DNA Bending: a Common Theme in Prokaryotic Gene Expression. Microbiological Reviews, 58: 268-290, (1994).

* 20. Perez-Martin, J. and Espinosa, M., Correlation between DNA bending and transcriptional activation at a plasmid promoter. J Mol Biol, 244:2417 (1994).

21. Perez-Martin, J., Timmis, K.N., and Delorenzo, V., Coregulation by bent DNA - functional substitutions of the integration host factor site at sigma(54)-dependent promoter pu of the upper-tol operon by intrinsically curved sequences. J Biol Chem, 269: 22657-22662, (1994).

22. Travers, A.A. DNA bending by sequence and proteins. In DNA-Protein Interactions. L D.M.J., ed. (Oxford: IRL Press), pp. 49-75.(1995).

 




  back Back to the GENETICS Syllabus Chromosome icon



Last modified on: 2 February, 2000 by Dave Ussery