(1 pt.)
What is your name?______________________________
1. Provide the information for the following sequence:
5' GATCTAGGACTATCGATGATCTAGTACGTACTGAGGGTACTAGAAT3'
a.
(2 pts.) What is the
sequence of the other strand of DNA?
(to get full credit, the sequence
must be written in the correct order)
HINT:
You can just write the sequence underneath - just make sure you label the
5' and 3' ends
b.
(2 pts.) What is the
sequence of the complimentary strand of RNA?
2. (5 pts.) Name 5 enzymes associated with DNA replication.
|
"Gee, you sure got me stumped there - I guess I'll have to set up a Presidential task force to help me answer this Genetics Quiz!" Don't worry Mr. President - it's not that bad - maybe you should tell your advisors to have a look at my LECTURE notes, and also tell them they can practice on a GREAT WEB SITE from PBS (and thank you Mr. President for not letting that mean ole' Congress kill Big Bird!). |
Back to the Genetics syllabus
Last modified on: 1 February, 2000 by Dave Ussery