please explain your answer!)
(2 pt.)
What is your name?______________________________
1. (3
pts.) If a protein were to bind
to the sequence below, where would be a good place to bend the DNA?
(please explain your answer!)
5’TGCGGGAAAGTACATTTCGGAATCCCTGATGATATATACGCCCGGAGCGATCAAACGATACG
3’
2.a. (2
pts.) Draw a piece of DNA that is
plectonemically supercoiled.
2.b.
(3 pts.)
Draw a piece of DNA that is torroidaly supercoiled.
be sure your drawing is roughly
the same scale from part a.
Back to the Genetics syllabus
Last modified on: 1 February, 2000 by Dave Ussery